Incidental Mutation 'R8410:Heatr5a'
ID652637
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene NameHEAT repeat containing 5A
SynonymsD930036F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R8410 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location51875871-51971321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51938120 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 637 (I637F)
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
Predicted Effect probably benign
Transcript: ENSMUST00000040583
AA Change: I637F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: I637F

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A T 12: 110,668,711 M131K probably benign Het
Alox15 T C 11: 70,344,927 T569A probably benign Het
Arfgef1 A G 1: 10,159,642 V1278A possibly damaging Het
Armc5 C T 7: 128,240,151 R214C probably damaging Het
Asl A G 5: 130,013,510 F242L possibly damaging Het
Atoh1 G A 6: 64,729,650 G110S probably benign Het
Caskin1 T C 17: 24,502,149 F488L possibly damaging Het
Chsy1 T A 7: 66,125,463 L180Q probably damaging Het
D1Pas1 A T 1: 186,968,315 Q147L probably benign Het
D930020B18Rik A G 10: 121,685,530 probably benign Het
Dnah7b T A 1: 46,356,659 probably null Het
Dsp A G 13: 38,196,815 E2512G possibly damaging Het
Eci2 T C 13: 34,978,035 K351R probably benign Het
Fam46b A G 4: 133,487,051 Q411R possibly damaging Het
Frem2 A G 3: 53,539,177 V2390A possibly damaging Het
Frmpd2 G A 14: 33,495,667 A40T probably damaging Het
Gapdhs G A 7: 30,737,910 P77S unknown Het
Jakmip1 G A 5: 37,117,484 V449M possibly damaging Het
Myh14 G T 7: 44,633,483 F737L probably damaging Het
Nbea A G 3: 56,037,263 V560A probably damaging Het
Olfr1291-ps1 T A 2: 111,499,702 M150K probably damaging Het
Olfr1396 A T 11: 49,113,684 I14N possibly damaging Het
Olfr702 T A 7: 106,824,538 probably benign Het
Olfr986 C T 9: 40,187,436 T107I possibly damaging Het
Prex2 G T 1: 11,153,657 R735L possibly damaging Het
Rrm2 T C 12: 24,708,623 S55P probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ruvbl2 T C 7: 45,431,332 I19V probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Slc15a5 A T 6: 138,012,155 M147K Het
St3gal5 A G 6: 72,142,297 D158G probably benign Het
Stac3 G A 10: 127,503,330 D103N probably damaging Het
Syt2 G A 1: 134,746,864 E347K possibly damaging Het
Ticrr A G 7: 79,667,675 E319G probably damaging Het
Ttn A G 2: 76,709,641 S34334P probably damaging Het
Uqcrb C A 13: 66,900,786 R100L unknown Het
Usp43 T G 11: 67,856,320 T854P probably damaging Het
Vmn2r102 T C 17: 19,677,934 Y404H possibly damaging Het
Wrn C T 8: 33,269,020 G970D probably damaging Het
Zfp456 A G 13: 67,372,796 Y27H probably damaging Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Zyx A T 6: 42,356,450 N437Y probably benign Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 splice site probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
R8088:Heatr5a UTSW 12 51947996 missense possibly damaging 0.85
R8205:Heatr5a UTSW 12 51959009 missense probably benign 0.05
R8212:Heatr5a UTSW 12 51899229 missense probably benign 0.00
R8213:Heatr5a UTSW 12 51891443 missense probably damaging 0.96
R8323:Heatr5a UTSW 12 51955506 missense probably benign 0.02
R8326:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8339:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8395:Heatr5a UTSW 12 51916178 missense
R8676:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8834:Heatr5a UTSW 12 51909956 critical splice donor site probably null
R8916:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCTTCCTCTGCCAAAGGAATC -3'
(R):5'- TCTCTTAGCAATCCCAGGAAATTCTTG -3'

Sequencing Primer
(F):5'- GGAATCAAGTCTATCAGCTTGC -3'
(R):5'- CTGAATGTTCTGGTCTCGT -3'
Posted On2020-10-20