Incidental Mutation 'R8410:Sall3'
ID652646
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8410 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80973754 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 320 (P320S)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: P320S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: P320S

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A T 12: 110,668,711 M131K probably benign Het
Alox15 T C 11: 70,344,927 T569A probably benign Het
Arfgef1 A G 1: 10,159,642 V1278A possibly damaging Het
Armc5 C T 7: 128,240,151 R214C probably damaging Het
Asl A G 5: 130,013,510 F242L possibly damaging Het
Atoh1 G A 6: 64,729,650 G110S probably benign Het
Caskin1 T C 17: 24,502,149 F488L possibly damaging Het
Chsy1 T A 7: 66,125,463 L180Q probably damaging Het
D1Pas1 A T 1: 186,968,315 Q147L probably benign Het
D930020B18Rik A G 10: 121,685,530 probably benign Het
Dnah7b T A 1: 46,356,659 probably null Het
Dsp A G 13: 38,196,815 E2512G possibly damaging Het
Eci2 T C 13: 34,978,035 K351R probably benign Het
Fam46b A G 4: 133,487,051 Q411R possibly damaging Het
Frem2 A G 3: 53,539,177 V2390A possibly damaging Het
Frmpd2 G A 14: 33,495,667 A40T probably damaging Het
Gapdhs G A 7: 30,737,910 P77S unknown Het
Heatr5a T A 12: 51,938,120 I637F probably benign Het
Jakmip1 G A 5: 37,117,484 V449M possibly damaging Het
Myh14 G T 7: 44,633,483 F737L probably damaging Het
Nbea A G 3: 56,037,263 V560A probably damaging Het
Olfr1291-ps1 T A 2: 111,499,702 M150K probably damaging Het
Olfr1396 A T 11: 49,113,684 I14N possibly damaging Het
Olfr702 T A 7: 106,824,538 probably benign Het
Olfr986 C T 9: 40,187,436 T107I possibly damaging Het
Prex2 G T 1: 11,153,657 R735L possibly damaging Het
Rrm2 T C 12: 24,708,623 S55P probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ruvbl2 T C 7: 45,431,332 I19V probably benign Het
Slc15a5 A T 6: 138,012,155 M147K Het
St3gal5 A G 6: 72,142,297 D158G probably benign Het
Stac3 G A 10: 127,503,330 D103N probably damaging Het
Syt2 G A 1: 134,746,864 E347K possibly damaging Het
Ticrr A G 7: 79,667,675 E319G probably damaging Het
Ttn A G 2: 76,709,641 S34334P probably damaging Het
Uqcrb C A 13: 66,900,786 R100L unknown Het
Usp43 T G 11: 67,856,320 T854P probably damaging Het
Vmn2r102 T C 17: 19,677,934 Y404H possibly damaging Het
Wrn C T 8: 33,269,020 G970D probably damaging Het
Zfp456 A G 13: 67,372,796 Y27H probably damaging Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Zyx A T 6: 42,356,450 N437Y probably benign Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 80973450 missense probably benign 0.01
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4022:Sall3 UTSW 18 80969840 missense probably benign 0.05
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5274:Sall3 UTSW 18 80969837 missense probably benign 0.15
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7496:Sall3 UTSW 18 80973364 missense probably benign 0.07
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R7809:Sall3 UTSW 18 80974360 missense probably benign 0.00
R8244:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8245:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8250:Sall3 UTSW 18 80973528 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8360:Sall3 UTSW 18 80974017 missense probably benign 0.31
R8476:Sall3 UTSW 18 80972118 nonsense probably null
R8712:Sall3 UTSW 18 80974021 missense probably benign 0.03
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCAGCAATGCTAACCAG -3'
(R):5'- CTCAGTACAGCTTCAGGGTC -3'

Sequencing Primer
(F):5'- TTGGGGAAGATGACACTGCTG -3'
(R):5'- AGTACAGCTTCAGGGTCTGACTC -3'
Posted On2020-10-20