Incidental Mutation 'R8411:Cfap61'
ID 652657
Institutional Source Beutler Lab
Gene Symbol Cfap61
Ensembl Gene ENSMUSG00000037143
Gene Name cilia and flagella associated protein 61
Synonyms 4930529M08Rik
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 145776704-146056959 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 145789103 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 94 (E94G)
Ref Sequence ENSEMBL: ENSMUSP00000112099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116398] [ENSMUST00000118002] [ENSMUST00000126415] [ENSMUST00000130168] [ENSMUST00000133433] [ENSMUST00000138774] [ENSMUST00000152515]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000116398
AA Change: E94G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112099
Gene: ENSMUSG00000037143
AA Change: E94G

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 237 1e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118002
AA Change: E94G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113529
Gene: ENSMUSG00000037143
AA Change: E94G

DomainStartEndE-ValueType
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126415
AA Change: E94G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118626
Gene: ENSMUSG00000037143
AA Change: E94G

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 244 1e-5 SMART
low complexity region 355 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130168
AA Change: E94G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121294
Gene: ENSMUSG00000037143
AA Change: E94G

DomainStartEndE-ValueType
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133433
AA Change: E94G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000118411
Gene: ENSMUSG00000037143
AA Change: E94G

DomainStartEndE-ValueType
Pfam:DUF4821 15 272 1.1e-96 PFAM
low complexity region 355 368 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 1172 1182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138774
AA Change: K36E

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120838
Gene: ENSMUSG00000037143
AA Change: K36E

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
SCOP:d1b87a_ 99 153 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152515
AA Change: E94G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Cfap61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02838:Cfap61 APN 2 145,789,084 (GRCm39) nonsense probably null
IGL03024:Cfap61 APN 2 145,781,919 (GRCm39) splice site probably benign
1mM(1):Cfap61 UTSW 2 146,042,680 (GRCm39) missense probably damaging 1.00
R0006:Cfap61 UTSW 2 145,919,232 (GRCm39) missense probably benign 0.06
R0396:Cfap61 UTSW 2 145,791,864 (GRCm39) missense possibly damaging 0.88
R0458:Cfap61 UTSW 2 145,850,837 (GRCm39) missense probably benign 0.08
R0477:Cfap61 UTSW 2 145,781,836 (GRCm39) missense probably damaging 1.00
R0513:Cfap61 UTSW 2 145,877,215 (GRCm39) missense possibly damaging 0.93
R1104:Cfap61 UTSW 2 145,792,981 (GRCm39) nonsense probably null
R1413:Cfap61 UTSW 2 145,805,363 (GRCm39) missense probably benign 0.27
R1591:Cfap61 UTSW 2 145,987,378 (GRCm39) missense probably benign 0.17
R1599:Cfap61 UTSW 2 145,854,083 (GRCm39) missense probably benign
R1661:Cfap61 UTSW 2 145,877,239 (GRCm39) splice site probably null
R1665:Cfap61 UTSW 2 145,877,239 (GRCm39) splice site probably null
R1789:Cfap61 UTSW 2 145,781,913 (GRCm39) critical splice donor site probably null
R1800:Cfap61 UTSW 2 145,884,542 (GRCm39) missense probably damaging 1.00
R2050:Cfap61 UTSW 2 145,987,393 (GRCm39) missense probably benign 0.26
R2202:Cfap61 UTSW 2 146,056,600 (GRCm39) missense probably damaging 1.00
R2220:Cfap61 UTSW 2 145,878,736 (GRCm39) critical splice acceptor site probably null
R2444:Cfap61 UTSW 2 145,877,239 (GRCm39) splice site probably null
R3779:Cfap61 UTSW 2 145,792,714 (GRCm39) missense probably damaging 1.00
R4668:Cfap61 UTSW 2 145,985,056 (GRCm39) missense probably damaging 0.99
R4705:Cfap61 UTSW 2 145,877,122 (GRCm39) missense probably damaging 1.00
R4763:Cfap61 UTSW 2 145,859,287 (GRCm39) missense probably benign 0.00
R4816:Cfap61 UTSW 2 145,985,020 (GRCm39) missense probably damaging 1.00
R5067:Cfap61 UTSW 2 145,943,956 (GRCm39) missense probably damaging 0.99
R5120:Cfap61 UTSW 2 145,985,080 (GRCm39) nonsense probably null
R5308:Cfap61 UTSW 2 145,951,908 (GRCm39) missense probably damaging 0.99
R5575:Cfap61 UTSW 2 145,859,313 (GRCm39) missense probably benign 0.31
R5834:Cfap61 UTSW 2 145,971,069 (GRCm39) missense probably benign 0.29
R5959:Cfap61 UTSW 2 145,789,053 (GRCm39) missense probably benign 0.00
R6190:Cfap61 UTSW 2 145,789,053 (GRCm39) missense probably benign 0.00
R6283:Cfap61 UTSW 2 145,971,022 (GRCm39) splice site probably null
R6786:Cfap61 UTSW 2 145,887,363 (GRCm39) missense possibly damaging 0.84
R6933:Cfap61 UTSW 2 145,792,970 (GRCm39) splice site probably null
R7071:Cfap61 UTSW 2 145,843,832 (GRCm39) missense probably benign 0.02
R7132:Cfap61 UTSW 2 145,951,870 (GRCm39) missense probably damaging 0.97
R7312:Cfap61 UTSW 2 145,887,390 (GRCm39) nonsense probably null
R7390:Cfap61 UTSW 2 145,843,802 (GRCm39) missense probably benign 0.00
R7446:Cfap61 UTSW 2 145,995,758 (GRCm39) missense probably benign 0.00
R7515:Cfap61 UTSW 2 145,884,645 (GRCm39) missense unknown
R7608:Cfap61 UTSW 2 145,805,451 (GRCm39) missense possibly damaging 0.73
R7609:Cfap61 UTSW 2 145,954,453 (GRCm39) missense unknown
R7780:Cfap61 UTSW 2 145,995,692 (GRCm39) missense possibly damaging 0.77
R7908:Cfap61 UTSW 2 145,944,019 (GRCm39) missense probably damaging 1.00
R7938:Cfap61 UTSW 2 145,887,376 (GRCm39) missense probably benign 0.09
R8054:Cfap61 UTSW 2 145,815,438 (GRCm39) missense probably damaging 1.00
R8153:Cfap61 UTSW 2 146,042,704 (GRCm39) missense probably benign 0.26
R8195:Cfap61 UTSW 2 145,789,095 (GRCm39) missense probably benign
R8224:Cfap61 UTSW 2 145,781,800 (GRCm39) missense probably benign
R8702:Cfap61 UTSW 2 146,042,710 (GRCm39) missense probably benign
R8936:Cfap61 UTSW 2 145,791,879 (GRCm39) missense possibly damaging 0.95
R9036:Cfap61 UTSW 2 145,850,839 (GRCm39) missense probably benign 0.05
R9079:Cfap61 UTSW 2 145,781,859 (GRCm39) missense probably benign 0.02
R9137:Cfap61 UTSW 2 146,042,685 (GRCm39) missense probably benign 0.01
R9184:Cfap61 UTSW 2 145,919,308 (GRCm39) missense probably null 1.00
R9423:Cfap61 UTSW 2 145,985,155 (GRCm39) missense probably damaging 1.00
R9467:Cfap61 UTSW 2 145,971,149 (GRCm39) missense probably benign
R9477:Cfap61 UTSW 2 145,985,032 (GRCm39) missense probably benign 0.01
R9646:Cfap61 UTSW 2 145,854,152 (GRCm39) missense probably damaging 1.00
R9688:Cfap61 UTSW 2 145,878,758 (GRCm39) missense probably damaging 0.98
X0022:Cfap61 UTSW 2 145,971,010 (GRCm39) missense probably benign 0.28
Z1088:Cfap61 UTSW 2 145,971,147 (GRCm39) missense probably benign 0.27
Z1177:Cfap61 UTSW 2 145,995,720 (GRCm39) missense probably damaging 1.00
Z1177:Cfap61 UTSW 2 145,854,082 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAGAAGGAGTCGACCTGCCTTC -3'
(R):5'- TGATGAGGCCACCATGTACC -3'

Sequencing Primer
(F):5'- GGAGTCGACCTGCCTTCATCTC -3'
(R):5'- GTACACTCTGGCCTCCTGG -3'
Posted On 2020-10-20