Incidental Mutation 'R8411:Mmp24'
ID 652658
Institutional Source Beutler Lab
Gene Symbol Mmp24
Ensembl Gene ENSMUSG00000027612
Gene Name matrix metallopeptidase 24
Synonyms Membrane type 5-MMP, MT5-MMP
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 155617262-155660286 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 155655935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 458 (V458L)
Ref Sequence ENSEMBL: ENSMUSP00000029141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029141] [ENSMUST00000124586]
AlphaFold Q9R0S2
Predicted Effect probably benign
Transcript: ENSMUST00000029141
AA Change: V458L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029141
Gene: ENSMUSG00000027612
AA Change: V458L

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:PG_binding_1 52 107 6.9e-14 PFAM
ZnMc 132 301 1.78e-60 SMART
low complexity region 323 346 N/A INTRINSIC
HX 357 400 7.4e-9 SMART
HX 402 446 7.01e-10 SMART
HX 449 495 6.49e-14 SMART
HX 497 542 6.64e-11 SMART
Pfam:DUF3377 548 618 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124586
SMART Domains Protein: ENSMUSP00000145349
Gene: ENSMUSG00000074649

DomainStartEndE-ValueType
low complexity region 7 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein do not develop neuropathic pain with mechanical allodynia after sciatic nerve injury, display enhanced sensitivity to noxious thermal stimuli under basal conditions, and develop hyperalgesia during inflammation. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene fail to develop neuropathic pain after peripheral nerve injury. They also experience reduced stress and enhanced mechanical coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Mmp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Mmp24 APN 2 155,641,807 (GRCm39) missense probably damaging 1.00
IGL02089:Mmp24 APN 2 155,654,213 (GRCm39) missense probably damaging 1.00
IGL02452:Mmp24 APN 2 155,657,708 (GRCm39) missense probably damaging 1.00
R0600:Mmp24 UTSW 2 155,634,517 (GRCm39) missense probably benign 0.01
R1381:Mmp24 UTSW 2 155,656,047 (GRCm39) missense possibly damaging 0.46
R4497:Mmp24 UTSW 2 155,655,908 (GRCm39) missense possibly damaging 0.85
R4498:Mmp24 UTSW 2 155,655,908 (GRCm39) missense possibly damaging 0.85
R4727:Mmp24 UTSW 2 155,657,819 (GRCm39) missense possibly damaging 0.55
R4985:Mmp24 UTSW 2 155,656,016 (GRCm39) missense probably damaging 0.99
R5020:Mmp24 UTSW 2 155,652,204 (GRCm39) missense probably benign 0.09
R5501:Mmp24 UTSW 2 155,640,056 (GRCm39) missense probably damaging 1.00
R5686:Mmp24 UTSW 2 155,641,697 (GRCm39) missense probably damaging 0.99
R5709:Mmp24 UTSW 2 155,634,462 (GRCm39) missense probably damaging 1.00
R5773:Mmp24 UTSW 2 155,641,829 (GRCm39) missense probably damaging 1.00
R6452:Mmp24 UTSW 2 155,657,673 (GRCm39) missense possibly damaging 0.67
R6657:Mmp24 UTSW 2 155,640,099 (GRCm39) missense probably damaging 1.00
R7015:Mmp24 UTSW 2 155,634,544 (GRCm39) missense probably damaging 0.99
R7699:Mmp24 UTSW 2 155,640,096 (GRCm39) missense probably damaging 0.99
R8076:Mmp24 UTSW 2 155,649,481 (GRCm39) nonsense probably null
R8111:Mmp24 UTSW 2 155,649,345 (GRCm39) missense possibly damaging 0.81
R8139:Mmp24 UTSW 2 155,655,965 (GRCm39) nonsense probably null
R8304:Mmp24 UTSW 2 155,641,759 (GRCm39) missense possibly damaging 0.85
R8344:Mmp24 UTSW 2 155,652,223 (GRCm39) missense possibly damaging 0.68
R8527:Mmp24 UTSW 2 155,641,634 (GRCm39) missense probably benign 0.02
R8542:Mmp24 UTSW 2 155,641,634 (GRCm39) missense probably benign 0.02
R9198:Mmp24 UTSW 2 155,640,041 (GRCm39) missense probably benign 0.19
R9500:Mmp24 UTSW 2 155,654,195 (GRCm39) missense probably damaging 1.00
Z1176:Mmp24 UTSW 2 155,652,312 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGGCTTTTGCTCCACAGG -3'
(R):5'- TCAGCTTGGCCCTTACATAC -3'

Sequencing Primer
(F):5'- GGGGCTAAAACTCACATTCCGG -3'
(R):5'- ATACATCCTTCCTTGCTGATGAAGG -3'
Posted On 2020-10-20