Incidental Mutation 'R8411:Arfgef2'
ID 652659
Institutional Source Beutler Lab
Gene Symbol Arfgef2
Ensembl Gene ENSMUSG00000074582
Gene Name ADP ribosylation factor guanine nucleotide exchange factor 2
Synonyms BIG2, E230011G24Rik
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.381) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 166647508-166739972 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 166715903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 1397 (Q1397H)
Ref Sequence ENSEMBL: ENSMUSP00000096677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099078]
AlphaFold A2A5R2
Predicted Effect probably benign
Transcript: ENSMUST00000099078
AA Change: Q1397H

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096677
Gene: ENSMUSG00000074582
AA Change: Q1397H

DomainStartEndE-ValueType
Pfam:DCB 7 200 1.6e-40 PFAM
Pfam:Sec7_N 377 536 3.7e-53 PFAM
Blast:Sec7 549 598 8e-18 BLAST
low complexity region 621 633 N/A INTRINSIC
Sec7 647 834 1.55e-97 SMART
Blast:Sec7 853 888 2e-11 BLAST
Blast:Sec7 902 941 4e-15 BLAST
low complexity region 1044 1055 N/A INTRINSIC
Pfam:DUF1981 1174 1257 6e-38 PFAM
low complexity region 1719 1729 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It contains a Sec7 domain, which may be responsible for its guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exencephaly, midline gut closure defects, periventricular and subependymal heterotopia, and impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Arfgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Arfgef2 APN 2 166,727,773 (GRCm39) missense probably damaging 1.00
IGL01323:Arfgef2 APN 2 166,713,415 (GRCm39) missense probably damaging 1.00
IGL01415:Arfgef2 APN 2 166,709,275 (GRCm39) missense probably damaging 0.98
IGL01638:Arfgef2 APN 2 166,715,865 (GRCm39) missense probably damaging 0.97
IGL02618:Arfgef2 APN 2 166,695,233 (GRCm39) missense probably damaging 1.00
IGL02899:Arfgef2 APN 2 166,710,971 (GRCm39) splice site probably benign
IGL03012:Arfgef2 APN 2 166,710,808 (GRCm39) splice site probably benign
IGL03063:Arfgef2 APN 2 166,701,702 (GRCm39) splice site probably benign
migrainous UTSW 2 166,676,383 (GRCm39) frame shift probably null
Scotomata UTSW 2 166,693,199 (GRCm39) critical splice donor site probably null
shimmering UTSW 2 166,668,848 (GRCm39) missense probably benign
R0102:Arfgef2 UTSW 2 166,687,385 (GRCm39) missense probably benign 0.00
R0102:Arfgef2 UTSW 2 166,687,385 (GRCm39) missense probably benign 0.00
R0116:Arfgef2 UTSW 2 166,715,603 (GRCm39) missense probably damaging 1.00
R0128:Arfgef2 UTSW 2 166,677,639 (GRCm39) missense probably damaging 1.00
R0130:Arfgef2 UTSW 2 166,677,639 (GRCm39) missense probably damaging 1.00
R0208:Arfgef2 UTSW 2 166,709,342 (GRCm39) missense probably damaging 1.00
R0379:Arfgef2 UTSW 2 166,702,320 (GRCm39) critical splice donor site probably null
R0945:Arfgef2 UTSW 2 166,668,889 (GRCm39) unclassified probably benign
R1226:Arfgef2 UTSW 2 166,669,560 (GRCm39) missense probably damaging 1.00
R1252:Arfgef2 UTSW 2 166,701,877 (GRCm39) missense probably damaging 1.00
R1695:Arfgef2 UTSW 2 166,706,632 (GRCm39) missense probably damaging 0.98
R1696:Arfgef2 UTSW 2 166,703,558 (GRCm39) missense probably damaging 1.00
R1742:Arfgef2 UTSW 2 166,708,900 (GRCm39) missense probably damaging 1.00
R1935:Arfgef2 UTSW 2 166,705,523 (GRCm39) missense probably benign 0.28
R1936:Arfgef2 UTSW 2 166,705,523 (GRCm39) missense probably benign 0.28
R1939:Arfgef2 UTSW 2 166,715,548 (GRCm39) missense probably damaging 1.00
R2276:Arfgef2 UTSW 2 166,707,679 (GRCm39) missense probably benign 0.00
R2279:Arfgef2 UTSW 2 166,707,679 (GRCm39) missense probably benign 0.00
R2349:Arfgef2 UTSW 2 166,693,948 (GRCm39) missense probably damaging 1.00
R2359:Arfgef2 UTSW 2 166,702,539 (GRCm39) missense probably damaging 1.00
R2414:Arfgef2 UTSW 2 166,687,424 (GRCm39) missense probably benign 0.00
R2519:Arfgef2 UTSW 2 166,723,164 (GRCm39) missense probably benign 0.03
R2938:Arfgef2 UTSW 2 166,736,653 (GRCm39) missense probably damaging 1.00
R3696:Arfgef2 UTSW 2 166,695,220 (GRCm39) nonsense probably null
R4022:Arfgef2 UTSW 2 166,715,865 (GRCm39) missense probably benign 0.01
R4227:Arfgef2 UTSW 2 166,709,244 (GRCm39) missense probably damaging 1.00
R4293:Arfgef2 UTSW 2 166,732,211 (GRCm39) missense probably benign
R4455:Arfgef2 UTSW 2 166,736,635 (GRCm39) missense probably benign 0.43
R4499:Arfgef2 UTSW 2 166,727,734 (GRCm39) missense probably damaging 0.99
R4570:Arfgef2 UTSW 2 166,698,458 (GRCm39) missense probably damaging 0.99
R4888:Arfgef2 UTSW 2 166,677,533 (GRCm39) missense probably damaging 1.00
R4893:Arfgef2 UTSW 2 166,708,876 (GRCm39) missense probably benign
R5032:Arfgef2 UTSW 2 166,720,464 (GRCm39) missense probably benign
R5191:Arfgef2 UTSW 2 166,718,431 (GRCm39) missense probably damaging 1.00
R5200:Arfgef2 UTSW 2 166,702,604 (GRCm39) missense probably benign 0.00
R5318:Arfgef2 UTSW 2 166,715,891 (GRCm39) missense probably damaging 1.00
R5378:Arfgef2 UTSW 2 166,715,548 (GRCm39) missense probably damaging 1.00
R5537:Arfgef2 UTSW 2 166,698,513 (GRCm39) splice site probably null
R5866:Arfgef2 UTSW 2 166,678,177 (GRCm39) missense possibly damaging 0.88
R5878:Arfgef2 UTSW 2 166,712,137 (GRCm39) missense probably benign 0.41
R5972:Arfgef2 UTSW 2 166,733,756 (GRCm39) missense probably damaging 1.00
R6147:Arfgef2 UTSW 2 166,713,415 (GRCm39) missense probably damaging 1.00
R6293:Arfgef2 UTSW 2 166,715,508 (GRCm39) missense possibly damaging 0.92
R6323:Arfgef2 UTSW 2 166,676,404 (GRCm39) missense probably damaging 1.00
R6338:Arfgef2 UTSW 2 166,687,490 (GRCm39) missense probably damaging 1.00
R6538:Arfgef2 UTSW 2 166,735,541 (GRCm39) splice site probably null
R6726:Arfgef2 UTSW 2 166,735,540 (GRCm39) critical splice donor site probably null
R7047:Arfgef2 UTSW 2 166,693,865 (GRCm39) splice site probably null
R7086:Arfgef2 UTSW 2 166,718,536 (GRCm39) missense probably damaging 1.00
R7108:Arfgef2 UTSW 2 166,715,528 (GRCm39) missense possibly damaging 0.80
R7155:Arfgef2 UTSW 2 166,707,733 (GRCm39) missense probably benign 0.19
R7159:Arfgef2 UTSW 2 166,668,848 (GRCm39) missense probably benign
R7482:Arfgef2 UTSW 2 166,693,199 (GRCm39) critical splice donor site probably null
R7598:Arfgef2 UTSW 2 166,698,444 (GRCm39) missense probably benign
R7869:Arfgef2 UTSW 2 166,715,623 (GRCm39) missense probably damaging 1.00
R8003:Arfgef2 UTSW 2 166,695,208 (GRCm39) missense probably damaging 1.00
R8092:Arfgef2 UTSW 2 166,701,754 (GRCm39) missense probably damaging 1.00
R8093:Arfgef2 UTSW 2 166,736,577 (GRCm39) missense probably benign 0.02
R8110:Arfgef2 UTSW 2 166,720,464 (GRCm39) missense probably benign 0.01
R8130:Arfgef2 UTSW 2 166,678,170 (GRCm39) missense possibly damaging 0.81
R8153:Arfgef2 UTSW 2 166,676,383 (GRCm39) frame shift probably null
R8156:Arfgef2 UTSW 2 166,676,383 (GRCm39) frame shift probably null
R8418:Arfgef2 UTSW 2 166,698,468 (GRCm39) missense probably benign 0.19
R8738:Arfgef2 UTSW 2 166,708,867 (GRCm39) missense probably benign 0.00
R8826:Arfgef2 UTSW 2 166,677,386 (GRCm39) intron probably benign
R8967:Arfgef2 UTSW 2 166,677,662 (GRCm39) missense probably damaging 1.00
R8971:Arfgef2 UTSW 2 166,701,221 (GRCm39) missense probably damaging 1.00
R8972:Arfgef2 UTSW 2 166,709,253 (GRCm39) missense possibly damaging 0.67
R9010:Arfgef2 UTSW 2 166,701,284 (GRCm39) missense probably damaging 1.00
R9077:Arfgef2 UTSW 2 166,706,721 (GRCm39) missense probably damaging 1.00
R9249:Arfgef2 UTSW 2 166,733,690 (GRCm39) missense probably damaging 1.00
R9306:Arfgef2 UTSW 2 166,723,188 (GRCm39) missense probably benign 0.02
R9394:Arfgef2 UTSW 2 166,676,469 (GRCm39) missense probably benign 0.13
R9776:Arfgef2 UTSW 2 166,713,447 (GRCm39) missense probably damaging 1.00
X0040:Arfgef2 UTSW 2 166,701,803 (GRCm39) missense probably damaging 1.00
X0063:Arfgef2 UTSW 2 166,733,761 (GRCm39) missense probably benign 0.32
Z1088:Arfgef2 UTSW 2 166,735,515 (GRCm39) missense possibly damaging 0.78
Z1176:Arfgef2 UTSW 2 166,736,632 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGAGTCGCTTCTTACCCC -3'
(R):5'- ACTGGTCTAAGATGGTCAGTGC -3'

Sequencing Primer
(F):5'- GCCTCCATCTCAGTTTGGC -3'
(R):5'- CAGTGCTTCTGTCCACTTGTAGAAG -3'
Posted On 2020-10-20