Incidental Mutation 'R8411:Pcdh10'
ID 652662
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Name protocadherin 10
Synonyms Olpc, OL-pc, 6430521D13Rik, 6430703F07Rik
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.231) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 45332833-45389014 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45333974 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 96 (E96G)
Ref Sequence ENSEMBL: ENSMUSP00000131073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]
AlphaFold E9PXQ7
Predicted Effect probably damaging
Transcript: ENSMUST00000166126
AA Change: E96G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: E96G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170695
AA Change: E96G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: E96G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171554
AA Change: E96G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: E96G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193252
AA Change: E96G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100
AA Change: E96G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45,334,737 (GRCm39) missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45,347,210 (GRCm39) missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45,334,078 (GRCm39) missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45,333,922 (GRCm39) missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45,333,832 (GRCm39) missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45,334,733 (GRCm39) missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45,335,377 (GRCm39) missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45,334,922 (GRCm39) missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45,347,052 (GRCm39) missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45,334,448 (GRCm39) missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45,333,797 (GRCm39) missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45,333,937 (GRCm39) missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45,335,947 (GRCm39) missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45,334,934 (GRCm39) missense possibly damaging 0.93
R0157:Pcdh10 UTSW 3 45,334,136 (GRCm39) missense probably damaging 1.00
R0372:Pcdh10 UTSW 3 45,333,932 (GRCm39) missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45,334,199 (GRCm39) missense probably damaging 1.00
R0760:Pcdh10 UTSW 3 45,335,005 (GRCm39) missense probably benign 0.19
R0976:Pcdh10 UTSW 3 45,335,236 (GRCm39) missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45,336,314 (GRCm39) missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45,334,409 (GRCm39) missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45,334,409 (GRCm39) missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45,333,838 (GRCm39) missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45,334,747 (GRCm39) missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45,336,316 (GRCm39) nonsense probably null
R1687:Pcdh10 UTSW 3 45,334,450 (GRCm39) missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45,336,316 (GRCm39) nonsense probably null
R1751:Pcdh10 UTSW 3 45,338,612 (GRCm39) missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45,338,612 (GRCm39) missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45,334,372 (GRCm39) missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45,334,906 (GRCm39) missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45,333,749 (GRCm39) missense probably benign
R4083:Pcdh10 UTSW 3 45,347,142 (GRCm39) missense probably damaging 1.00
R4084:Pcdh10 UTSW 3 45,347,142 (GRCm39) missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45,336,055 (GRCm39) missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45,335,072 (GRCm39) missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45,333,917 (GRCm39) missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45,336,296 (GRCm39) missense probably damaging 1.00
R5224:Pcdh10 UTSW 3 45,347,249 (GRCm39) missense probably damaging 0.99
R5233:Pcdh10 UTSW 3 45,338,626 (GRCm39) missense probably damaging 1.00
R5261:Pcdh10 UTSW 3 45,336,247 (GRCm39) missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45,338,635 (GRCm39) missense probably benign 0.00
R5488:Pcdh10 UTSW 3 45,335,803 (GRCm39) missense probably damaging 1.00
R5558:Pcdh10 UTSW 3 45,338,603 (GRCm39) missense probably damaging 1.00
R5784:Pcdh10 UTSW 3 45,335,075 (GRCm39) missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45,347,156 (GRCm39) missense probably benign 0.04
R6283:Pcdh10 UTSW 3 45,335,989 (GRCm39) missense possibly damaging 0.46
R6396:Pcdh10 UTSW 3 45,334,495 (GRCm39) missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45,335,734 (GRCm39) missense possibly damaging 0.87
R6756:Pcdh10 UTSW 3 45,334,541 (GRCm39) missense possibly damaging 0.80
R6968:Pcdh10 UTSW 3 45,333,977 (GRCm39) missense probably damaging 1.00
R7463:Pcdh10 UTSW 3 45,338,007 (GRCm39) missense possibly damaging 0.59
R7574:Pcdh10 UTSW 3 45,335,810 (GRCm39) missense possibly damaging 0.92
R7691:Pcdh10 UTSW 3 45,335,632 (GRCm39) missense probably damaging 1.00
R7795:Pcdh10 UTSW 3 45,334,657 (GRCm39) missense probably benign 0.09
R8057:Pcdh10 UTSW 3 45,333,694 (GRCm39) missense probably benign 0.00
R8082:Pcdh10 UTSW 3 45,336,179 (GRCm39) missense probably damaging 1.00
R8302:Pcdh10 UTSW 3 45,335,933 (GRCm39) missense probably damaging 0.99
R8555:Pcdh10 UTSW 3 45,334,030 (GRCm39) missense probably benign 0.41
R8765:Pcdh10 UTSW 3 45,333,923 (GRCm39) missense probably damaging 1.00
R8940:Pcdh10 UTSW 3 45,338,620 (GRCm39) missense possibly damaging 0.83
R9146:Pcdh10 UTSW 3 45,334,351 (GRCm39) missense probably benign 0.08
R9306:Pcdh10 UTSW 3 45,335,804 (GRCm39) missense probably benign 0.30
R9330:Pcdh10 UTSW 3 45,335,618 (GRCm39) missense probably damaging 0.96
R9714:Pcdh10 UTSW 3 45,336,010 (GRCm39) missense probably damaging 0.98
X0013:Pcdh10 UTSW 3 45,334,001 (GRCm39) missense probably damaging 1.00
Z1177:Pcdh10 UTSW 3 45,336,164 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAACATGGCACTTTCGTGGG -3'
(R):5'- TTATCTCGTAGTCTCGCAAGGAG -3'

Sequencing Primer
(F):5'- AATATCGCTGAAGACCTGGGC -3'
(R):5'- AGTCTCGCAAGGAGTTGGTC -3'
Posted On 2020-10-20