Incidental Mutation 'R8411:Ptx3'
ID 652663
Institutional Source Beutler Lab
Gene Symbol Ptx3
Ensembl Gene ENSMUSG00000027832
Gene Name pentraxin related gene
Synonyms TSG-14, pentraxin 3
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 66219910-66225805 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66224780 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 241 (S241G)
Ref Sequence ENSEMBL: ENSMUSP00000029421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029419] [ENSMUST00000029421]
AlphaFold P48759
Predicted Effect probably benign
Transcript: ENSMUST00000029419
SMART Domains Protein: ENSMUSP00000029419
Gene: ENSMUSG00000027831

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
Blast:PH 586 626 1e-5 BLAST
PH 717 821 1.44e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029421
AA Change: S241G

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029421
Gene: ENSMUSG00000027832
AA Change: S241G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 123 144 N/A INTRINSIC
PTX 175 381 5.82e-89 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pentraxin protein family. The expression of this protein is induced by inflammatory cytokines in response to inflammatory stimuli in several mesenchymal and epithelial cell types, particularly endothelial cells and mononuclear phagocytes. The protein promotes fibrocyte differentiation and is involved in regulating inflammation and complement activation. It also plays a role in angiogenesis and tissue remodeling. The protein serves as a biomarker for several inflammatory conditions. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous mutant mice display female subfertility due to abnormalities of the cumulus oophorus and are susceptible to invasive pulmonary aspergillosis associated with defective recognition of conidia by alveolar macrophages and dendritic cells and impaired induction of adaptive type 2 responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,137,722 S89P probably benign Het
Aatf A T 11: 84,470,676 M367K probably benign Het
Adam18 A T 8: 24,652,127 I211N probably damaging Het
Angpt1 T C 15: 42,427,034 Y478C probably damaging Het
Apba2 A T 7: 64,736,926 I434F probably damaging Het
Arfgef1 T A 1: 10,216,534 K50N probably benign Het
Arfgef2 A T 2: 166,873,983 Q1397H probably benign Het
Ascc2 G A 11: 4,647,208 R129Q probably damaging Het
Atxn1 A G 13: 45,566,556 V621A probably benign Het
Catsperz A T 19: 6,922,562 L192M probably benign Het
Cd5 G A 19: 10,720,221 P465S probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cfap61 A G 2: 145,947,183 E94G probably benign Het
Chd1 A G 17: 15,762,449 H1392R probably damaging Het
Csnk1a1 A G 18: 61,555,817 I23V probably benign Het
Ctnnd2 C T 15: 30,647,033 R292C probably benign Het
Dcaf6 T A 1: 165,388,675 H453L probably benign Het
Dnah3 C A 7: 120,011,030 D1728Y probably damaging Het
Dtx3 T C 10: 127,192,824 K179E possibly damaging Het
Fam3b T A 16: 97,481,853 Y74F probably benign Het
Gm5464 T C 14: 66,869,106 L64P unknown Het
Gm5624 T G 14: 44,561,890 N70T Het
Kcnh7 T A 2: 62,764,608 H706L probably damaging Het
Kdm2b C T 5: 122,880,176 R1067H probably damaging Het
Klhl28 A T 12: 64,950,090 H492Q probably damaging Het
Loxl3 T A 6: 83,050,624 C716S probably damaging Het
Ltbp2 A G 12: 84,786,413 Y1474H probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Mmp24 G T 2: 155,814,015 V458L probably benign Het
Mpl C A 4: 118,446,109 S502I Het
Nfatc1 A T 18: 80,667,042 V503D probably damaging Het
Nim1k A G 13: 119,714,271 I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 Y327C probably damaging Het
Olfr1214 T C 2: 88,988,065 T46A probably benign Het
Oma1 C T 4: 103,328,916 R360* probably null Het
Oog2 T A 4: 144,194,173 W59R probably damaging Het
Pcdh10 A G 3: 45,379,539 E96G probably damaging Het
Pcna T A 2: 132,251,930 T98S probably benign Het
Pcnx3 C T 19: 5,679,590 C899Y possibly damaging Het
Phf11d T C 14: 59,356,434 N97S probably benign Het
Plekhg4 G A 8: 105,377,329 W431* probably null Het
Plk4 A G 3: 40,813,466 T815A probably benign Het
Pnma2 C T 14: 66,916,313 T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 R548W probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rplp0 A T 5: 115,560,764 K26N probably damaging Het
Sec62 A C 3: 30,818,782 E338A unknown Het
Sema6a T C 18: 47,248,955 M842V probably benign Het
Serpina3j T C 12: 104,314,784 V72A probably benign Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc29a4 A G 5: 142,720,125 N455D probably damaging Het
Slc6a11 T A 6: 114,131,437 F54Y probably benign Het
Spag6 G A 2: 18,710,583 V80M probably damaging Het
Spic T C 10: 88,678,636 E34G possibly damaging Het
Tecpr2 A G 12: 110,931,720 K469E possibly damaging Het
Them7 T A 2: 105,297,845 L57Q probably benign Het
Tlr3 G A 8: 45,396,941 A897V probably damaging Het
Tnp2 A G 16: 10,788,508 C32R possibly damaging Het
Trpm6 A T 19: 18,853,968 Q1399L probably benign Het
Ttn C A 2: 76,846,671 E11074* probably null Het
Ubash3b G A 9: 41,043,485 A243V probably benign Het
Vash1 G A 12: 86,680,178 R64Q possibly damaging Het
Vmn1r167 T A 7: 23,505,556 M12L possibly damaging Het
Vmn2r111 T A 17: 22,548,581 H645L probably benign Het
Vmn2r75 A T 7: 86,148,514 I697K probably damaging Het
Vmn2r87 A G 10: 130,472,257 I704T probably damaging Het
Other mutations in Ptx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02877:Ptx3 APN 3 66224775 missense probably damaging 1.00
R0674:Ptx3 UTSW 3 66224727 missense probably damaging 1.00
R1966:Ptx3 UTSW 3 66224621 missense probably damaging 1.00
R2114:Ptx3 UTSW 3 66224766 missense probably damaging 1.00
R2116:Ptx3 UTSW 3 66224766 missense probably damaging 1.00
R3717:Ptx3 UTSW 3 66224955 missense probably benign 0.01
R4222:Ptx3 UTSW 3 66224706 missense probably damaging 1.00
R4898:Ptx3 UTSW 3 66224991 missense probably damaging 1.00
R5426:Ptx3 UTSW 3 66220722 missense probably damaging 0.99
R5942:Ptx3 UTSW 3 66220063 start codon destroyed probably null 1.00
R6061:Ptx3 UTSW 3 66224709 missense possibly damaging 0.95
R6216:Ptx3 UTSW 3 66224844 missense probably damaging 1.00
R7165:Ptx3 UTSW 3 66224970 missense probably benign 0.03
R7253:Ptx3 UTSW 3 66224947 missense probably benign 0.03
R8458:Ptx3 UTSW 3 66220998 missense probably benign 0.02
R8958:Ptx3 UTSW 3 66220970 missense probably benign 0.11
R9046:Ptx3 UTSW 3 66224732 missense probably damaging 0.99
Z1176:Ptx3 UTSW 3 66220835 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGTTGTGAAACAGCAATTTTCTTCC -3'
(R):5'- TGGCCAATCTGTAGGAGTCC -3'

Sequencing Primer
(F):5'- GAAACAGCAATTTTCTTCCCAATGCG -3'
(R):5'- CCCTCAGGAACAGAGTGACTTTTG -3'
Posted On 2020-10-20