Incidental Mutation 'R8411:Mpl'
ID 652665
Institutional Source Beutler Lab
Gene Symbol Mpl
Ensembl Gene ENSMUSG00000006389
Gene Name myeloproliferative leukemia virus oncogene
Synonyms c-mpl-I, TPO-R, thrombopoietin receptor, c-mpl, CD110, hlb219, c-mpl-II
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 118299612-118314710 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 118303306 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 502 (S502I)
Ref Sequence ENSEMBL: ENSMUSP00000006556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000106375]
AlphaFold Q08351
Predicted Effect
SMART Domains Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389
AA Change: S502I

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 1.9e-31 PFAM
Pfam:IL6Ra-bind 27 118 1.8e-7 PFAM
FN3 126 257 7.7e-3 SMART
FN3 382 461 2.83e0 SMART
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102671
AA Change: S494I

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389
AA Change: S494I

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.4e-32 PFAM
Pfam:IL6Ra-bind 34 125 7.3e-9 PFAM
FN3 133 256 1.09e-2 SMART
FN3 381 460 2.83e0 SMART
transmembrane domain 482 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106375
AA Change: S435I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389
AA Change: S435I

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 9.4e-32 PFAM
Pfam:IL6Ra-bind 27 119 7.4e-8 PFAM
FN3 322 401 2.83e0 SMART
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168404
SMART Domains Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.9e-31 PFAM
FN3 133 264 7.7e-3 SMART
FN3 389 468 2.83e0 SMART
transmembrane domain 490 512 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Mpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Mpl APN 4 118,312,858 (GRCm39) missense possibly damaging 0.94
IGL02096:Mpl APN 4 118,314,333 (GRCm39) missense possibly damaging 0.46
IGL02681:Mpl APN 4 118,306,068 (GRCm39) splice site probably benign
R0238:Mpl UTSW 4 118,314,060 (GRCm39) splice site probably benign
R0309:Mpl UTSW 4 118,303,235 (GRCm39) intron probably benign
R0539:Mpl UTSW 4 118,300,705 (GRCm39) missense possibly damaging 0.68
R0558:Mpl UTSW 4 118,301,217 (GRCm39) missense probably damaging 0.99
R0601:Mpl UTSW 4 118,300,733 (GRCm39) missense probably benign 0.08
R0784:Mpl UTSW 4 118,303,603 (GRCm39) missense possibly damaging 0.59
R1016:Mpl UTSW 4 118,306,110 (GRCm39) missense probably damaging 1.00
R1532:Mpl UTSW 4 118,305,765 (GRCm39) missense possibly damaging 0.63
R1590:Mpl UTSW 4 118,301,221 (GRCm39) missense probably damaging 0.99
R1806:Mpl UTSW 4 118,300,729 (GRCm39) missense possibly damaging 0.73
R1875:Mpl UTSW 4 118,314,026 (GRCm39) missense probably benign
R1935:Mpl UTSW 4 118,312,936 (GRCm39) missense probably benign 0.01
R2182:Mpl UTSW 4 118,314,610 (GRCm39) missense probably benign
R2291:Mpl UTSW 4 118,306,197 (GRCm39) missense probably benign 0.04
R2508:Mpl UTSW 4 118,312,954 (GRCm39) missense probably damaging 1.00
R4242:Mpl UTSW 4 118,313,968 (GRCm39) missense probably damaging 0.98
R4718:Mpl UTSW 4 118,313,921 (GRCm39) missense probably benign 0.02
R4775:Mpl UTSW 4 118,305,777 (GRCm39) missense probably damaging 1.00
R5158:Mpl UTSW 4 118,313,881 (GRCm39) missense probably damaging 0.98
R5208:Mpl UTSW 4 118,313,078 (GRCm39) missense probably benign 0.00
R5276:Mpl UTSW 4 118,312,918 (GRCm39) missense probably benign
R5953:Mpl UTSW 4 118,311,708 (GRCm39) missense probably damaging 0.99
R5953:Mpl UTSW 4 118,311,707 (GRCm39) missense possibly damaging 0.89
R6439:Mpl UTSW 4 118,305,750 (GRCm39) missense probably damaging 0.98
R6450:Mpl UTSW 4 118,305,897 (GRCm39) splice site probably null
R6521:Mpl UTSW 4 118,312,314 (GRCm39) critical splice donor site probably null
R6812:Mpl UTSW 4 118,312,461 (GRCm39) missense probably benign 0.03
R6876:Mpl UTSW 4 118,314,317 (GRCm39) missense probably damaging 1.00
R7095:Mpl UTSW 4 118,301,260 (GRCm39) missense
R7100:Mpl UTSW 4 118,314,607 (GRCm39) missense
R7173:Mpl UTSW 4 118,305,741 (GRCm39) critical splice donor site probably null
R7177:Mpl UTSW 4 118,305,741 (GRCm39) critical splice donor site probably null
R7512:Mpl UTSW 4 118,306,089 (GRCm39) missense
R8377:Mpl UTSW 4 118,301,254 (GRCm39) missense
R8458:Mpl UTSW 4 118,301,213 (GRCm39) critical splice donor site probably null
R8498:Mpl UTSW 4 118,306,207 (GRCm39) missense probably benign
R8672:Mpl UTSW 4 118,306,110 (GRCm39) missense probably damaging 1.00
R8863:Mpl UTSW 4 118,314,602 (GRCm39) missense
R8904:Mpl UTSW 4 118,301,263 (GRCm39) missense
Z1177:Mpl UTSW 4 118,300,852 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGTGTAAGAACTTCACTCCCAGAG -3'
(R):5'- TATGGGCAAGCCTCAGAAC -3'

Sequencing Primer
(F):5'- GAACTTCACTCCCAGAGGCGAG -3'
(R):5'- GCCTCAGAACTCAGCGCAG -3'
Posted On 2020-10-20