Mutagenetix > Incidental Mutation

Incidental Mutation 'R8411:Mpl'

652665

Institutional Source

Beutler Lab

Gene Symbol

Mpl

Ensembl Gene

ENSMUSG00000006389

Gene Name

myeloproliferative leukemia virus oncogene

Synonyms

TPO-R, thrombopoietin receptor, c-mpl, hlb219, CD110, c-mpl-I, c-mpl-II

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118442415-118457513 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 118446109 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 502 (S502I)

Ref Sequence

ENSEMBL: ENSMUSP00000006556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000106375]

AlphaFold

Q08351

Predicted Effect

SMART Domains

Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389
AA Change: S502I

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	18	121	1.9e-31	PFAM
Pfam:IL6Ra-bind	27	118	1.8e-7	PFAM
FN3	126	257	7.7e-3	SMART
FN3	382	461	2.83e0	SMART
transmembrane domain	483	505	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102671
AA Change: S494I

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389
AA Change: S494I

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	25	128	1.4e-32	PFAM
Pfam:IL6Ra-bind	34	125	7.3e-9	PFAM
FN3	133	256	1.09e-2	SMART
FN3	381	460	2.83e0	SMART
transmembrane domain	482	504	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106375
AA Change: S435I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389
AA Change: S435I

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	18	121	9.4e-32	PFAM
Pfam:IL6Ra-bind	27	119	7.4e-8	PFAM
FN3	322	401	2.83e0	SMART
transmembrane domain	423	445	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168404

SMART Domains

Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	25	128	1.9e-31	PFAM
FN3	133	264	7.7e-3	SMART
FN3	389	468	2.83e0	SMART
transmembrane domain	490	512	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,137,722	S89P	probably benign	Het
Aatf	A	T	11: 84,470,676	M367K	probably benign	Het
Adam18	A	T	8: 24,652,127	I211N	probably damaging	Het
Angpt1	T	C	15: 42,427,034	Y478C	probably damaging	Het
Apba2	A	T	7: 64,736,926	I434F	probably damaging	Het
Arfgef1	T	A	1: 10,216,534	K50N	probably benign	Het
Arfgef2	A	T	2: 166,873,983	Q1397H	probably benign	Het
Ascc2	G	A	11: 4,647,208	R129Q	probably damaging	Het
Atxn1	A	G	13: 45,566,556	V621A	probably benign	Het
Catsperz	A	T	19: 6,922,562	L192M	probably benign	Het
Cd5	G	A	19: 10,720,221	P465S	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cfap61	A	G	2: 145,947,183	E94G	probably benign	Het
Chd1	A	G	17: 15,762,449	H1392R	probably damaging	Het
Csnk1a1	A	G	18: 61,555,817	I23V	probably benign	Het
Ctnnd2	C	T	15: 30,647,033	R292C	probably benign	Het
Dcaf6	T	A	1: 165,388,675	H453L	probably benign	Het
Dnah3	C	A	7: 120,011,030	D1728Y	probably damaging	Het
Dtx3	T	C	10: 127,192,824	K179E	possibly damaging	Het
Fam3b	T	A	16: 97,481,853	Y74F	probably benign	Het
Gm5464	T	C	14: 66,869,106	L64P	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Kcnh7	T	A	2: 62,764,608	H706L	probably damaging	Het
Kdm2b	C	T	5: 122,880,176	R1067H	probably damaging	Het
Klhl28	A	T	12: 64,950,090	H492Q	probably damaging	Het
Loxl3	T	A	6: 83,050,624	C716S	probably damaging	Het
Ltbp2	A	G	12: 84,786,413	Y1474H	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Mmp24	G	T	2: 155,814,015	V458L	probably benign	Het
Nfatc1	A	T	18: 80,667,042	V503D	probably damaging	Het
Nim1k	A	G	13: 119,714,271	I133T	possibly damaging	Het
Nr1d2	T	C	14: 18,215,031	Y327C	probably damaging	Het
Olfr1214	T	C	2: 88,988,065	T46A	probably benign	Het
Oma1	C	T	4: 103,328,916	R360*	probably null	Het
Oog2	T	A	4: 144,194,173	W59R	probably damaging	Het
Pcdh10	A	G	3: 45,379,539	E96G	probably damaging	Het
Pcna	T	A	2: 132,251,930	T98S	probably benign	Het
Pcnx3	C	T	19: 5,679,590	C899Y	possibly damaging	Het
Phf11d	T	C	14: 59,356,434	N97S	probably benign	Het
Plekhg4	G	A	8: 105,377,329	W431*	probably null	Het
Plk4	A	G	3: 40,813,466	T815A	probably benign	Het
Pnma2	C	T	14: 66,916,313	T62I	possibly damaging	Het
Ppp1r9a	C	T	6: 5,057,568	R548W	probably damaging	Het
Ptx3	A	G	3: 66,224,780	S241G	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rplp0	A	T	5: 115,560,764	K26N	probably damaging	Het
Sec62	A	C	3: 30,818,782	E338A	unknown	Het
Sema6a	T	C	18: 47,248,955	M842V	probably benign	Het
Serpina3j	T	C	12: 104,314,784	V72A	probably benign	Het
Siglecf	T	C	7: 43,351,944	F112S	probably damaging	Het
Slc29a4	A	G	5: 142,720,125	N455D	probably damaging	Het
Slc6a11	T	A	6: 114,131,437	F54Y	probably benign	Het
Spag6	G	A	2: 18,710,583	V80M	probably damaging	Het
Spic	T	C	10: 88,678,636	E34G	possibly damaging	Het
Tecpr2	A	G	12: 110,931,720	K469E	possibly damaging	Het
Them7	T	A	2: 105,297,845	L57Q	probably benign	Het
Tlr3	G	A	8: 45,396,941	A897V	probably damaging	Het
Tnp2	A	G	16: 10,788,508	C32R	possibly damaging	Het
Trpm6	A	T	19: 18,853,968	Q1399L	probably benign	Het
Ttn	C	A	2: 76,846,671	E11074*	probably null	Het
Ubash3b	G	A	9: 41,043,485	A243V	probably benign	Het
Vash1	G	A	12: 86,680,178	R64Q	possibly damaging	Het
Vmn1r167	T	A	7: 23,505,556	M12L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,581	H645L	probably benign	Het
Vmn2r75	A	T	7: 86,148,514	I697K	probably damaging	Het
Vmn2r87	A	G	10: 130,472,257	I704T	probably damaging	Het

Other mutations in Mpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Mpl	APN	4	118455661	missense	possibly damaging	0.94
IGL02096:Mpl	APN	4	118457136	missense	possibly damaging	0.46
IGL02681:Mpl	APN	4	118448871	splice site	probably benign
R0238:Mpl	UTSW	4	118456863	splice site	probably benign
R0309:Mpl	UTSW	4	118446038	intron	probably benign
R0539:Mpl	UTSW	4	118443508	missense	possibly damaging	0.68
R0558:Mpl	UTSW	4	118444020	missense	probably damaging	0.99
R0601:Mpl	UTSW	4	118443536	missense	probably benign	0.08
R0784:Mpl	UTSW	4	118446406	missense	possibly damaging	0.59
R1016:Mpl	UTSW	4	118448913	missense	probably damaging	1.00
R1532:Mpl	UTSW	4	118448568	missense	possibly damaging	0.63
R1590:Mpl	UTSW	4	118444024	missense	probably damaging	0.99
R1806:Mpl	UTSW	4	118443532	missense	possibly damaging	0.73
R1875:Mpl	UTSW	4	118456829	missense	probably benign
R1935:Mpl	UTSW	4	118455739	missense	probably benign	0.01
R2182:Mpl	UTSW	4	118457413	missense	probably benign
R2291:Mpl	UTSW	4	118449000	missense	probably benign	0.04
R2508:Mpl	UTSW	4	118455757	missense	probably damaging	1.00
R4242:Mpl	UTSW	4	118456771	missense	probably damaging	0.98
R4718:Mpl	UTSW	4	118456724	missense	probably benign	0.02
R4775:Mpl	UTSW	4	118448580	missense	probably damaging	1.00
R5158:Mpl	UTSW	4	118456684	missense	probably damaging	0.98
R5208:Mpl	UTSW	4	118455881	missense	probably benign	0.00
R5276:Mpl	UTSW	4	118455721	missense	probably benign
R5953:Mpl	UTSW	4	118454510	missense	possibly damaging	0.89
R5953:Mpl	UTSW	4	118454511	missense	probably damaging	0.99
R6439:Mpl	UTSW	4	118448553	missense	probably damaging	0.98
R6450:Mpl	UTSW	4	118448700	splice site	probably null
R6521:Mpl	UTSW	4	118455117	critical splice donor site	probably null
R6812:Mpl	UTSW	4	118455264	missense	probably benign	0.03
R6876:Mpl	UTSW	4	118457120	missense	probably damaging	1.00
R7095:Mpl	UTSW	4	118444063	missense
R7100:Mpl	UTSW	4	118457410	missense
R7173:Mpl	UTSW	4	118448544	critical splice donor site	probably null
R7177:Mpl	UTSW	4	118448544	critical splice donor site	probably null
R7512:Mpl	UTSW	4	118448892	missense
R8377:Mpl	UTSW	4	118444057	missense
R8458:Mpl	UTSW	4	118444016	critical splice donor site	probably null
R8498:Mpl	UTSW	4	118449010	missense	probably benign
R8672:Mpl	UTSW	4	118448913	missense	probably damaging	1.00
R8863:Mpl	UTSW	4	118457405	missense
R8904:Mpl	UTSW	4	118444066	missense
Z1177:Mpl	UTSW	4	118443655	missense

Predicted Primers

PCR Primer
(F):5'- TGTGTAAGAACTTCACTCCCAGAG -3'
(R):5'- TATGGGCAAGCCTCAGAAC -3'

Sequencing Primer
(F):5'- GAACTTCACTCCCAGAGGCGAG -3'
(R):5'- GCCTCAGAACTCAGCGCAG -3'

Posted On

2020-10-20