Mutagenetix > Incidental Mutation

Incidental Mutation 'R8411:Rplp0'

652669

Institutional Source

Beutler Lab

Gene Symbol

Rplp0

Ensembl Gene

ENSMUSG00000067274

Gene Name

ribosomal protein, large, P0

Synonyms

36B4, Arbp

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R8411 (G1)

Quality Score

170.009

Status

Not validated

Chromosome

Chromosomal Location

115559467-115563727 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 115560764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 26 (K26N)

Ref Sequence

ENSEMBL: ENSMUSP00000083705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064454] [ENSMUST00000067268] [ENSMUST00000086519] [ENSMUST00000152976] [ENSMUST00000156359]

AlphaFold

P14869

Predicted Effect

probably benign
Transcript: ENSMUST00000064454

SMART Domains

Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638

Domain	Start	End	E-Value	Type
low complexity region	64	84	N/A	INTRINSIC
low complexity region	108	117	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
Pfam:DUF3554	357	705	2e-61	PFAM
coiled coil region	806	866	N/A	INTRINSIC
Blast:ARM	1028	1068	6e-11	BLAST
coiled coil region	1180	1203	N/A	INTRINSIC
low complexity region	1457	1466	N/A	INTRINSIC
low complexity region	1501	1510	N/A	INTRINSIC
ARM	1527	1567	3.69e1	SMART
Blast:ARM	1602	1644	1e-5	BLAST
Blast:EZ_HEAT	1671	1704	1e-7	BLAST
low complexity region	1926	1934	N/A	INTRINSIC
low complexity region	1956	1972	N/A	INTRINSIC
ARM	2034	2070	9.27e1	SMART
low complexity region	2326	2334	N/A	INTRINSIC
ARM	2416	2455	2.16e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000067268

SMART Domains

Protein: ENSMUSP00000069624
Gene: ENSMUSG00000029528

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Pfam:Paxillin	44	253	1.6e-98	PFAM
low complexity region	281	300	N/A	INTRINSIC
LIM	323	374	3.99e-23	SMART
LIM	382	433	2.36e-16	SMART
LIM	441	492	8.16e-20	SMART
LIM	500	551	8.62e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000086519
AA Change: K26N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000083705
Gene: ENSMUSG00000067274
AA Change: K26N

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L10	5	106	2e-23	PFAM
low complexity region	109	117	N/A	INTRINSIC
Pfam:Ribosomal_60s	231	316	2.7e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000152976
AA Change: K26N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114332
Gene: ENSMUSG00000067274
AA Change: K26N

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L10	5	106	7.2e-27	PFAM
low complexity region	109	117	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156359

SMART Domains

Protein: ENSMUSP00000138289
Gene: ENSMUSG00000067274

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L10	1	67	1.1e-16	PFAM
low complexity region	70	78	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which is the functional equivalent of the E. coli L10 ribosomal protein, belongs to the L10P family of ribosomal proteins. It is a neutral phosphoprotein with a C-terminal end that is nearly identical to the C-terminal ends of the acidic ribosomal phosphoproteins P1 and P2. The P0 protein can interact with P1 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,137,722	S89P	probably benign	Het
Aatf	A	T	11: 84,470,676	M367K	probably benign	Het
Adam18	A	T	8: 24,652,127	I211N	probably damaging	Het
Angpt1	T	C	15: 42,427,034	Y478C	probably damaging	Het
Apba2	A	T	7: 64,736,926	I434F	probably damaging	Het
Arfgef1	T	A	1: 10,216,534	K50N	probably benign	Het
Arfgef2	A	T	2: 166,873,983	Q1397H	probably benign	Het
Ascc2	G	A	11: 4,647,208	R129Q	probably damaging	Het
Atxn1	A	G	13: 45,566,556	V621A	probably benign	Het
Catsperz	A	T	19: 6,922,562	L192M	probably benign	Het
Cd5	G	A	19: 10,720,221	P465S	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cfap61	A	G	2: 145,947,183	E94G	probably benign	Het
Chd1	A	G	17: 15,762,449	H1392R	probably damaging	Het
Csnk1a1	A	G	18: 61,555,817	I23V	probably benign	Het
Ctnnd2	C	T	15: 30,647,033	R292C	probably benign	Het
Dcaf6	T	A	1: 165,388,675	H453L	probably benign	Het
Dnah3	C	A	7: 120,011,030	D1728Y	probably damaging	Het
Dtx3	T	C	10: 127,192,824	K179E	possibly damaging	Het
Fam3b	T	A	16: 97,481,853	Y74F	probably benign	Het
Gm5464	T	C	14: 66,869,106	L64P	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Kcnh7	T	A	2: 62,764,608	H706L	probably damaging	Het
Kdm2b	C	T	5: 122,880,176	R1067H	probably damaging	Het
Klhl28	A	T	12: 64,950,090	H492Q	probably damaging	Het
Loxl3	T	A	6: 83,050,624	C716S	probably damaging	Het
Ltbp2	A	G	12: 84,786,413	Y1474H	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Mmp24	G	T	2: 155,814,015	V458L	probably benign	Het
Mpl	C	A	4: 118,446,109	S502I		Het
Nfatc1	A	T	18: 80,667,042	V503D	probably damaging	Het
Nim1k	A	G	13: 119,714,271	I133T	possibly damaging	Het
Nr1d2	T	C	14: 18,215,031	Y327C	probably damaging	Het
Olfr1214	T	C	2: 88,988,065	T46A	probably benign	Het
Oma1	C	T	4: 103,328,916	R360*	probably null	Het
Oog2	T	A	4: 144,194,173	W59R	probably damaging	Het
Pcdh10	A	G	3: 45,379,539	E96G	probably damaging	Het
Pcna	T	A	2: 132,251,930	T98S	probably benign	Het
Pcnx3	C	T	19: 5,679,590	C899Y	possibly damaging	Het
Phf11d	T	C	14: 59,356,434	N97S	probably benign	Het
Plekhg4	G	A	8: 105,377,329	W431*	probably null	Het
Plk4	A	G	3: 40,813,466	T815A	probably benign	Het
Pnma2	C	T	14: 66,916,313	T62I	possibly damaging	Het
Ppp1r9a	C	T	6: 5,057,568	R548W	probably damaging	Het
Ptx3	A	G	3: 66,224,780	S241G	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Sec62	A	C	3: 30,818,782	E338A	unknown	Het
Sema6a	T	C	18: 47,248,955	M842V	probably benign	Het
Serpina3j	T	C	12: 104,314,784	V72A	probably benign	Het
Siglecf	T	C	7: 43,351,944	F112S	probably damaging	Het
Slc29a4	A	G	5: 142,720,125	N455D	probably damaging	Het
Slc6a11	T	A	6: 114,131,437	F54Y	probably benign	Het
Spag6	G	A	2: 18,710,583	V80M	probably damaging	Het
Spic	T	C	10: 88,678,636	E34G	possibly damaging	Het
Tecpr2	A	G	12: 110,931,720	K469E	possibly damaging	Het
Them7	T	A	2: 105,297,845	L57Q	probably benign	Het
Tlr3	G	A	8: 45,396,941	A897V	probably damaging	Het
Tnp2	A	G	16: 10,788,508	C32R	possibly damaging	Het
Trpm6	A	T	19: 18,853,968	Q1399L	probably benign	Het
Ttn	C	A	2: 76,846,671	E11074*	probably null	Het
Ubash3b	G	A	9: 41,043,485	A243V	probably benign	Het
Vash1	G	A	12: 86,680,178	R64Q	possibly damaging	Het
Vmn1r167	T	A	7: 23,505,556	M12L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,581	H645L	probably benign	Het
Vmn2r75	A	T	7: 86,148,514	I697K	probably damaging	Het
Vmn2r87	A	G	10: 130,472,257	I704T	probably damaging	Het

Other mutations in Rplp0

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02037:Rplp0	APN	5	115561115	missense	probably benign	0.03
R0494:Rplp0	UTSW	5	115559872	missense	possibly damaging	0.90
R1471:Rplp0	UTSW	5	115563344	missense	probably damaging	0.96
R1776:Rplp0	UTSW	5	115562465	missense	probably benign	0.30
R1872:Rplp0	UTSW	5	115563315	missense	possibly damaging	0.92
R2088:Rplp0	UTSW	5	115562503	missense	possibly damaging	0.89
R4629:Rplp0	UTSW	5	115561423	splice site	probably null
R5899:Rplp0	UTSW	5	115561430	missense	probably benign
R6171:Rplp0	UTSW	5	115561160	missense	probably benign	0.00
R8020:Rplp0	UTSW	5	115560844	missense	probably benign	0.25
R9767:Rplp0	UTSW	5	115561504	missense	probably benign	0.01
X0066:Rplp0	UTSW	5	115562528	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AAAGACAGACGTTGGGCTCG -3'
(R):5'- TATCCCGAATCTCAGTGAGGTC -3'

Sequencing Primer
(F):5'- GGGTGGCTGGCTCCTAG -3'
(R):5'- TCCTCCTTGGTGAACACGAAG -3'

Posted On

2020-10-20