Mutagenetix > Incidental Mutation

Incidental Mutation 'R8411:Slc29a4'

652671

Institutional Source

Beutler Lab

Gene Symbol

Slc29a4

Ensembl Gene

ENSMUSG00000050822

Gene Name

solute carrier family 29 (nucleoside transporters), member 4

Synonyms

mPMAT, ENT4

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

142692512-142722490 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 142720125 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 455 (N455D)

Ref Sequence

ENSEMBL: ENSMUSP00000059896 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058418] [ENSMUST00000152247]

AlphaFold

Q8R139

Predicted Effect

probably damaging
Transcript: ENSMUST00000058418
AA Change: N455D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059896
Gene: ENSMUSG00000050822
AA Change: N455D

Domain	Start	End	E-Value	Type
transmembrane domain	67	89	N/A	INTRINSIC
transmembrane domain	104	126	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Nucleoside_tran	170	501	2e-51	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152247

SMART Domains

Protein: ENSMUSP00000117651
Gene: ENSMUSG00000039477

Domain	Start	End	E-Value	Type
low complexity region	57	104	N/A	INTRINSIC
low complexity region	186	207	N/A	INTRINSIC
low complexity region	274	292	N/A	INTRINSIC
low complexity region	440	451	N/A	INTRINSIC
coiled coil region	660	693	N/A	INTRINSIC
low complexity region	733	747	N/A	INTRINSIC
low complexity region	768	787	N/A	INTRINSIC
low complexity region	797	810	N/A	INTRINSIC
low complexity region	910	929	N/A	INTRINSIC
low complexity region	1086	1106	N/A	INTRINSIC
coiled coil region	1228	1260	N/A	INTRINSIC
low complexity region	1294	1310	N/A	INTRINSIC
low complexity region	1398	1410	N/A	INTRINSIC
low complexity region	1425	1436	N/A	INTRINSIC
coiled coil region	1570	1592	N/A	INTRINSIC
low complexity region	1606	1618	N/A	INTRINSIC
low complexity region	1622	1640	N/A	INTRINSIC
low complexity region	1641	1653	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC29A/ENT transporter protein family. The encoded membrane protein catalyzes the reuptake of monoamines into presynaptic neurons, thus determining the intensity and duration of monoamine neural signaling. It has been shown to transport several compounds, including serotonin, dopamine, and the neurotoxin 1-methyl-4-phenylpyridinium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic cation and monoamine uptake in the choroid plexus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,137,722	S89P	probably benign	Het
Aatf	A	T	11: 84,470,676	M367K	probably benign	Het
Adam18	A	T	8: 24,652,127	I211N	probably damaging	Het
Angpt1	T	C	15: 42,427,034	Y478C	probably damaging	Het
Apba2	A	T	7: 64,736,926	I434F	probably damaging	Het
Arfgef1	T	A	1: 10,216,534	K50N	probably benign	Het
Arfgef2	A	T	2: 166,873,983	Q1397H	probably benign	Het
Ascc2	G	A	11: 4,647,208	R129Q	probably damaging	Het
Atxn1	A	G	13: 45,566,556	V621A	probably benign	Het
Catsperz	A	T	19: 6,922,562	L192M	probably benign	Het
Cd5	G	A	19: 10,720,221	P465S	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cfap61	A	G	2: 145,947,183	E94G	probably benign	Het
Chd1	A	G	17: 15,762,449	H1392R	probably damaging	Het
Csnk1a1	A	G	18: 61,555,817	I23V	probably benign	Het
Ctnnd2	C	T	15: 30,647,033	R292C	probably benign	Het
Dcaf6	T	A	1: 165,388,675	H453L	probably benign	Het
Dnah3	C	A	7: 120,011,030	D1728Y	probably damaging	Het
Dtx3	T	C	10: 127,192,824	K179E	possibly damaging	Het
Fam3b	T	A	16: 97,481,853	Y74F	probably benign	Het
Gm5464	T	C	14: 66,869,106	L64P	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Kcnh7	T	A	2: 62,764,608	H706L	probably damaging	Het
Kdm2b	C	T	5: 122,880,176	R1067H	probably damaging	Het
Klhl28	A	T	12: 64,950,090	H492Q	probably damaging	Het
Loxl3	T	A	6: 83,050,624	C716S	probably damaging	Het
Ltbp2	A	G	12: 84,786,413	Y1474H	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Mmp24	G	T	2: 155,814,015	V458L	probably benign	Het
Mpl	C	A	4: 118,446,109	S502I		Het
Nfatc1	A	T	18: 80,667,042	V503D	probably damaging	Het
Nim1k	A	G	13: 119,714,271	I133T	possibly damaging	Het
Nr1d2	T	C	14: 18,215,031	Y327C	probably damaging	Het
Olfr1214	T	C	2: 88,988,065	T46A	probably benign	Het
Oma1	C	T	4: 103,328,916	R360*	probably null	Het
Oog2	T	A	4: 144,194,173	W59R	probably damaging	Het
Pcdh10	A	G	3: 45,379,539	E96G	probably damaging	Het
Pcna	T	A	2: 132,251,930	T98S	probably benign	Het
Pcnx3	C	T	19: 5,679,590	C899Y	possibly damaging	Het
Phf11d	T	C	14: 59,356,434	N97S	probably benign	Het
Plekhg4	G	A	8: 105,377,329	W431*	probably null	Het
Plk4	A	G	3: 40,813,466	T815A	probably benign	Het
Pnma2	C	T	14: 66,916,313	T62I	possibly damaging	Het
Ppp1r9a	C	T	6: 5,057,568	R548W	probably damaging	Het
Ptx3	A	G	3: 66,224,780	S241G	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rplp0	A	T	5: 115,560,764	K26N	probably damaging	Het
Sec62	A	C	3: 30,818,782	E338A	unknown	Het
Sema6a	T	C	18: 47,248,955	M842V	probably benign	Het
Serpina3j	T	C	12: 104,314,784	V72A	probably benign	Het
Siglecf	T	C	7: 43,351,944	F112S	probably damaging	Het
Slc6a11	T	A	6: 114,131,437	F54Y	probably benign	Het
Spag6	G	A	2: 18,710,583	V80M	probably damaging	Het
Spic	T	C	10: 88,678,636	E34G	possibly damaging	Het
Tecpr2	A	G	12: 110,931,720	K469E	possibly damaging	Het
Them7	T	A	2: 105,297,845	L57Q	probably benign	Het
Tlr3	G	A	8: 45,396,941	A897V	probably damaging	Het
Tnp2	A	G	16: 10,788,508	C32R	possibly damaging	Het
Trpm6	A	T	19: 18,853,968	Q1399L	probably benign	Het
Ttn	C	A	2: 76,846,671	E11074*	probably null	Het
Ubash3b	G	A	9: 41,043,485	A243V	probably benign	Het
Vash1	G	A	12: 86,680,178	R64Q	possibly damaging	Het
Vmn1r167	T	A	7: 23,505,556	M12L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,581	H645L	probably benign	Het
Vmn2r75	A	T	7: 86,148,514	I697K	probably damaging	Het
Vmn2r87	A	G	10: 130,472,257	I704T	probably damaging	Het

Other mutations in Slc29a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01317:Slc29a4	APN	5	142705530	missense	probably benign	0.02
IGL01717:Slc29a4	APN	5	142718746	missense	probably damaging	1.00
IGL02184:Slc29a4	APN	5	142717751	missense	probably damaging	1.00
IGL02207:Slc29a4	APN	5	142718885	missense	possibly damaging	0.76
IGL02210:Slc29a4	APN	5	142718779	missense	probably damaging	1.00
IGL02323:Slc29a4	APN	5	142717652	missense	probably damaging	0.99
IGL02381:Slc29a4	APN	5	142720099	missense	probably benign	0.34
IGL03103:Slc29a4	APN	5	142712080	missense	probably damaging	1.00
IGL03210:Slc29a4	APN	5	142715108	missense	probably damaging	1.00
R0131:Slc29a4	UTSW	5	142705530	missense	probably benign	0.02
R0131:Slc29a4	UTSW	5	142705530	missense	probably benign	0.02
R0132:Slc29a4	UTSW	5	142705530	missense	probably benign	0.02
R0850:Slc29a4	UTSW	5	142718572	missense	probably benign	0.00
R1777:Slc29a4	UTSW	5	142714062	missense	probably damaging	0.96
R1864:Slc29a4	UTSW	5	142717754	missense	probably damaging	1.00
R1870:Slc29a4	UTSW	5	142721488	makesense	probably null
R1871:Slc29a4	UTSW	5	142721488	makesense	probably null
R2092:Slc29a4	UTSW	5	142718855	missense	probably damaging	1.00
R2196:Slc29a4	UTSW	5	142712895	missense	possibly damaging	0.94
R4716:Slc29a4	UTSW	5	142718572	missense	probably benign	0.00
R5002:Slc29a4	UTSW	5	142718746	missense	probably damaging	1.00
R5162:Slc29a4	UTSW	5	142721452	missense	possibly damaging	0.80
R5235:Slc29a4	UTSW	5	142718768	missense	probably damaging	1.00
R5553:Slc29a4	UTSW	5	142720036	missense	probably damaging	1.00
R5642:Slc29a4	UTSW	5	142711972	missense	probably damaging	1.00
R5688:Slc29a4	UTSW	5	142714098	missense	possibly damaging	0.68
R5930:Slc29a4	UTSW	5	142721402	missense	possibly damaging	0.90
R5944:Slc29a4	UTSW	5	142718818	missense	probably damaging	1.00
R6056:Slc29a4	UTSW	5	142720077	missense	probably damaging	0.99
R6409:Slc29a4	UTSW	5	142712071	missense	probably damaging	1.00
R6934:Slc29a4	UTSW	5	142712958	missense	probably benign	0.02
R7508:Slc29a4	UTSW	5	142718506	missense	probably benign	0.00
R7509:Slc29a4	UTSW	5	142718506	missense	probably benign	0.00
R7716:Slc29a4	UTSW	5	142718506	missense	probably benign	0.00
R7910:Slc29a4	UTSW	5	142705401	missense	probably benign	0.00
R8351:Slc29a4	UTSW	5	142717829	missense	probably benign	0.01
R8408:Slc29a4	UTSW	5	142705354	critical splice acceptor site	probably null
R8749:Slc29a4	UTSW	5	142715064	missense	probably damaging	1.00
R8861:Slc29a4	UTSW	5	142718825	missense	probably damaging	0.96
R9236:Slc29a4	UTSW	5	142712947	missense	probably damaging	0.98
R9498:Slc29a4	UTSW	5	142718478	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGAGACGGGCTTATGGCTAG -3'
(R):5'- TGGCCATCTCTATCTCAGAACTG -3'

Sequencing Primer
(F):5'- GGTAATCCCAGACTCCCTGC -3'
(R):5'- TGTAACCCCGCAAATGTGG -3'

Posted On

2020-10-20