Incidental Mutation 'R8411:Ppp1r9a'
ID 652672
Institutional Source Beutler Lab
Gene Symbol Ppp1r9a
Ensembl Gene ENSMUSG00000032827
Gene Name protein phosphatase 1, regulatory subunit 9A
Synonyms NRB, neurabin-I, Neurabin I, A230094E16Rik, 4930518N04Rik, 2810430P21Rik
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.433) question?
Stock # R8411 (G1)
Quality Score 210.009
Status Not validated
Chromosome 6
Chromosomal Location 4902917-5165661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 5057568 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 548 (R548W)
Ref Sequence ENSEMBL: ENSMUSP00000135629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000168998] [ENSMUST00000175889] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177456]
AlphaFold H3BJD6
Predicted Effect probably damaging
Transcript: ENSMUST00000035813
AA Change: R548W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827
AA Change: R548W

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 5e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1052 6.41e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168998
AA Change: R548W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126643
Gene: ENSMUSG00000032827
AA Change: R548W

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175889
AA Change: R548W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827
AA Change: R548W

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1041 1.72e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176263
AA Change: R548W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827
AA Change: R548W

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
low complexity region 643 649 N/A INTRINSIC
Blast:PDZ 763 800 2e-15 BLAST
low complexity region 806 820 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176729
AA Change: R228W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827
AA Change: R228W

DomainStartEndE-ValueType
low complexity region 96 115 N/A INTRINSIC
PDB:3HVQ|D 116 232 4e-79 PDB
SCOP:d1be9a_ 174 232 5e-9 SMART
Blast:PDZ 193 232 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177153
AA Change: R548W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827
AA Change: R548W

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177456
AA Change: R548W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827
AA Change: R548W

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1040 1049 N/A INTRINSIC
low complexity region 1103 1114 N/A INTRINSIC
SAM 1183 1249 6.41e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Ppp1r9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ppp1r9a APN 6 5,158,195 (GRCm39) missense possibly damaging 0.72
IGL00796:Ppp1r9a APN 6 5,157,014 (GRCm39) missense probably benign 0.37
IGL00906:Ppp1r9a APN 6 5,157,023 (GRCm39) missense possibly damaging 0.62
IGL01662:Ppp1r9a APN 6 5,115,322 (GRCm39) missense probably damaging 1.00
IGL01695:Ppp1r9a APN 6 5,064,003 (GRCm39) missense probably damaging 1.00
IGL01807:Ppp1r9a APN 6 5,158,248 (GRCm39) nonsense probably null
IGL02126:Ppp1r9a APN 6 5,156,229 (GRCm39) missense probably damaging 1.00
IGL02423:Ppp1r9a APN 6 4,906,537 (GRCm39) missense probably benign 0.25
IGL03343:Ppp1r9a APN 6 5,046,015 (GRCm39) missense probably damaging 1.00
IGL03365:Ppp1r9a APN 6 5,110,993 (GRCm39) splice site probably benign
R0545:Ppp1r9a UTSW 6 5,115,357 (GRCm39) missense probably benign 0.45
R1126:Ppp1r9a UTSW 6 4,906,795 (GRCm39) missense possibly damaging 0.93
R1137:Ppp1r9a UTSW 6 5,159,697 (GRCm39) missense possibly damaging 0.46
R1443:Ppp1r9a UTSW 6 5,057,557 (GRCm39) missense probably damaging 1.00
R1484:Ppp1r9a UTSW 6 5,113,712 (GRCm39) nonsense probably null
R1545:Ppp1r9a UTSW 6 5,156,242 (GRCm39) critical splice donor site probably null
R1627:Ppp1r9a UTSW 6 4,906,168 (GRCm39) missense possibly damaging 0.50
R1672:Ppp1r9a UTSW 6 5,143,491 (GRCm39) critical splice donor site probably null
R1826:Ppp1r9a UTSW 6 5,111,060 (GRCm39) splice site probably benign
R1834:Ppp1r9a UTSW 6 5,113,710 (GRCm39) missense probably damaging 0.98
R1874:Ppp1r9a UTSW 6 4,906,348 (GRCm39) missense possibly damaging 0.87
R2224:Ppp1r9a UTSW 6 5,154,074 (GRCm39) missense probably benign
R2227:Ppp1r9a UTSW 6 5,154,074 (GRCm39) missense probably benign
R2898:Ppp1r9a UTSW 6 4,906,558 (GRCm39) missense probably benign 0.01
R3606:Ppp1r9a UTSW 6 5,113,674 (GRCm39) missense possibly damaging 0.90
R3732:Ppp1r9a UTSW 6 4,906,259 (GRCm39) unclassified probably benign
R3927:Ppp1r9a UTSW 6 5,057,531 (GRCm39) missense probably damaging 1.00
R4631:Ppp1r9a UTSW 6 4,906,537 (GRCm39) missense possibly damaging 0.62
R4682:Ppp1r9a UTSW 6 4,905,477 (GRCm39) missense possibly damaging 0.48
R4766:Ppp1r9a UTSW 6 5,157,016 (GRCm39) missense probably benign 0.11
R5197:Ppp1r9a UTSW 6 5,156,177 (GRCm39) missense probably damaging 1.00
R5217:Ppp1r9a UTSW 6 5,115,367 (GRCm39) missense probably damaging 1.00
R5493:Ppp1r9a UTSW 6 5,159,702 (GRCm39) missense probably damaging 0.99
R5790:Ppp1r9a UTSW 6 5,134,363 (GRCm39) intron probably benign
R5828:Ppp1r9a UTSW 6 5,158,200 (GRCm39) missense probably damaging 1.00
R5896:Ppp1r9a UTSW 6 5,159,648 (GRCm39) missense probably damaging 1.00
R5930:Ppp1r9a UTSW 6 5,157,002 (GRCm39) critical splice acceptor site probably null
R5990:Ppp1r9a UTSW 6 5,134,660 (GRCm39) missense probably benign 0.05
R6017:Ppp1r9a UTSW 6 4,906,363 (GRCm39) missense probably benign 0.18
R6122:Ppp1r9a UTSW 6 4,905,509 (GRCm39) missense probably damaging 1.00
R6164:Ppp1r9a UTSW 6 5,110,715 (GRCm39) intron probably benign
R6175:Ppp1r9a UTSW 6 4,905,639 (GRCm39) nonsense probably null
R6188:Ppp1r9a UTSW 6 5,158,113 (GRCm39) nonsense probably null
R6233:Ppp1r9a UTSW 6 5,077,610 (GRCm39) missense probably damaging 1.00
R6321:Ppp1r9a UTSW 6 5,115,151 (GRCm39) missense probably damaging 1.00
R6449:Ppp1r9a UTSW 6 5,057,458 (GRCm39) missense probably benign 0.44
R6454:Ppp1r9a UTSW 6 4,905,827 (GRCm39) missense probably damaging 1.00
R6527:Ppp1r9a UTSW 6 5,045,949 (GRCm39) missense probably damaging 1.00
R7053:Ppp1r9a UTSW 6 4,905,670 (GRCm39) missense probably damaging 1.00
R7233:Ppp1r9a UTSW 6 5,134,804 (GRCm39) missense probably benign
R7238:Ppp1r9a UTSW 6 5,159,716 (GRCm39) missense probably damaging 1.00
R7438:Ppp1r9a UTSW 6 5,115,378 (GRCm39) missense probably damaging 0.99
R7497:Ppp1r9a UTSW 6 4,905,775 (GRCm39) missense probably damaging 1.00
R7666:Ppp1r9a UTSW 6 5,143,238 (GRCm39) missense probably benign 0.00
R7698:Ppp1r9a UTSW 6 4,906,430 (GRCm39) missense probably benign
R7850:Ppp1r9a UTSW 6 4,905,894 (GRCm39) missense possibly damaging 0.77
R8029:Ppp1r9a UTSW 6 5,057,518 (GRCm39) missense possibly damaging 0.76
R8392:Ppp1r9a UTSW 6 5,143,491 (GRCm39) critical splice donor site probably null
R8431:Ppp1r9a UTSW 6 5,115,456 (GRCm39) missense probably benign 0.01
R8699:Ppp1r9a UTSW 6 5,115,474 (GRCm39) missense probably benign 0.00
R8708:Ppp1r9a UTSW 6 5,115,196 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r9a UTSW 6 5,134,657 (GRCm39) missense probably benign 0.00
R9096:Ppp1r9a UTSW 6 4,906,012 (GRCm39) missense probably damaging 1.00
R9097:Ppp1r9a UTSW 6 4,906,012 (GRCm39) missense probably damaging 1.00
R9131:Ppp1r9a UTSW 6 5,134,106 (GRCm39) missense possibly damaging 0.86
R9279:Ppp1r9a UTSW 6 5,113,757 (GRCm39) missense probably damaging 1.00
R9512:Ppp1r9a UTSW 6 5,115,364 (GRCm39) missense probably damaging 0.99
R9512:Ppp1r9a UTSW 6 5,113,681 (GRCm39) missense probably benign 0.27
R9567:Ppp1r9a UTSW 6 5,157,004 (GRCm39) missense probably benign 0.34
R9672:Ppp1r9a UTSW 6 5,007,889 (GRCm39) missense unknown
R9687:Ppp1r9a UTSW 6 4,905,978 (GRCm39) missense probably damaging 1.00
R9715:Ppp1r9a UTSW 6 5,045,936 (GRCm39) missense probably damaging 0.96
RF007:Ppp1r9a UTSW 6 4,906,657 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCTCAGTTCTTAGAACAGG -3'
(R):5'- TCACTTCACACTGTGTAAGCAC -3'

Sequencing Primer
(F):5'- GTTCTTAGAACAGGACACACTCAG -3'
(R):5'- GCAGACAGACAGATGCACACTTAG -3'
Posted On 2020-10-20