Incidental Mutation 'R8411:Slc6a11'
ID 652675
Institutional Source Beutler Lab
Gene Symbol Slc6a11
Ensembl Gene ENSMUSG00000030307
Gene Name solute carrier family 6 (neurotransmitter transporter, GABA), member 11
Synonyms GAT4, Gabt4, E130202I16Rik, Gat3, D930045G19Rik
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 114108202-114226847 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114108398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 54 (F54Y)
Ref Sequence ENSEMBL: ENSMUSP00000032451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032451]
AlphaFold P31650
Predicted Effect probably benign
Transcript: ENSMUST00000032451
AA Change: F54Y

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032451
Gene: ENSMUSG00000030307
AA Change: F54Y

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:SNF 45 571 4.1e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent transporter that uptakes gamma-aminobutyric acid (GABA), an inhibitory neurotransmitter, which ends the GABA neurotransmission. Defects in this gene may result in epilepsy, behavioral problems, or intellectual problems. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted mutation display postnatal lethality. Mice heterozygous for a targeted mutation display resistance to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Slc6a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc6a11 APN 6 114,111,626 (GRCm39) missense probably damaging 1.00
IGL01306:Slc6a11 APN 6 114,111,626 (GRCm39) missense probably damaging 1.00
IGL01308:Slc6a11 APN 6 114,111,626 (GRCm39) missense probably damaging 1.00
IGL01616:Slc6a11 APN 6 114,111,829 (GRCm39) missense possibly damaging 0.93
IGL01985:Slc6a11 APN 6 114,111,853 (GRCm39) missense probably benign 0.43
IGL02270:Slc6a11 APN 6 114,215,357 (GRCm39) missense probably damaging 1.00
IGL02692:Slc6a11 APN 6 114,139,100 (GRCm39) missense probably damaging 1.00
IGL02828:Slc6a11 APN 6 114,111,948 (GRCm39) missense possibly damaging 0.53
IGL03135:Slc6a11 APN 6 114,171,570 (GRCm39) critical splice acceptor site probably null
ANU23:Slc6a11 UTSW 6 114,111,626 (GRCm39) missense probably damaging 1.00
R0603:Slc6a11 UTSW 6 114,221,851 (GRCm39) missense probably benign 0.03
R1147:Slc6a11 UTSW 6 114,221,831 (GRCm39) missense possibly damaging 0.90
R1147:Slc6a11 UTSW 6 114,221,831 (GRCm39) missense possibly damaging 0.90
R1219:Slc6a11 UTSW 6 114,202,772 (GRCm39) splice site probably benign
R1226:Slc6a11 UTSW 6 114,171,624 (GRCm39) missense possibly damaging 0.93
R1676:Slc6a11 UTSW 6 114,224,627 (GRCm39) missense probably benign
R2231:Slc6a11 UTSW 6 114,171,590 (GRCm39) missense probably damaging 1.00
R2297:Slc6a11 UTSW 6 114,108,386 (GRCm39) missense probably benign 0.37
R4384:Slc6a11 UTSW 6 114,224,688 (GRCm39) missense possibly damaging 0.47
R4556:Slc6a11 UTSW 6 114,221,773 (GRCm39) missense probably benign 0.00
R4564:Slc6a11 UTSW 6 114,108,323 (GRCm39) missense probably benign 0.00
R5488:Slc6a11 UTSW 6 114,220,855 (GRCm39) missense probably damaging 1.00
R5736:Slc6a11 UTSW 6 114,139,123 (GRCm39) missense probably damaging 1.00
R6021:Slc6a11 UTSW 6 114,207,012 (GRCm39) missense probably damaging 1.00
R6150:Slc6a11 UTSW 6 114,222,579 (GRCm39) missense probably benign 0.08
R6733:Slc6a11 UTSW 6 114,111,859 (GRCm39) missense probably damaging 1.00
R7391:Slc6a11 UTSW 6 114,215,422 (GRCm39) missense probably benign
R7451:Slc6a11 UTSW 6 114,222,644 (GRCm39) nonsense probably null
R7750:Slc6a11 UTSW 6 114,207,098 (GRCm39) missense possibly damaging 0.82
R8115:Slc6a11 UTSW 6 114,108,442 (GRCm39) missense probably damaging 1.00
R8179:Slc6a11 UTSW 6 114,222,567 (GRCm39) missense probably benign 0.01
R8512:Slc6a11 UTSW 6 114,215,402 (GRCm39) missense probably damaging 1.00
R8774:Slc6a11 UTSW 6 114,206,995 (GRCm39) splice site probably benign
R8963:Slc6a11 UTSW 6 114,202,782 (GRCm39) critical splice acceptor site probably null
R9032:Slc6a11 UTSW 6 114,202,808 (GRCm39) missense probably damaging 1.00
R9056:Slc6a11 UTSW 6 114,220,905 (GRCm39) missense probably benign 0.00
R9085:Slc6a11 UTSW 6 114,202,808 (GRCm39) missense probably damaging 1.00
R9407:Slc6a11 UTSW 6 114,220,914 (GRCm39) missense probably damaging 1.00
Z1177:Slc6a11 UTSW 6 114,224,603 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACCATCCCGGGATTCAAGC -3'
(R):5'- TAAAATACCAGTGAGAGTGGCC -3'

Sequencing Primer
(F):5'- GAGCCTCTCAAAAGCCCGG -3'
(R):5'- TGGCCTGAAAGCAGAGCTC -3'
Posted On 2020-10-20