Incidental Mutation 'R8411:Slc6a11'
ID 652675
Institutional Source Beutler Lab
Gene Symbol Slc6a11
Ensembl Gene ENSMUSG00000030307
Gene Name solute carrier family 6 (neurotransmitter transporter, GABA), member 11
Synonyms Gabt4, E130202I16Rik, Gat3, D930045G19Rik, GAT4
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 114131241-114249952 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114131437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 54 (F54Y)
Ref Sequence ENSEMBL: ENSMUSP00000032451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032451]
AlphaFold P31650
Predicted Effect probably benign
Transcript: ENSMUST00000032451
AA Change: F54Y

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032451
Gene: ENSMUSG00000030307
AA Change: F54Y

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:SNF 45 571 4.1e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent transporter that uptakes gamma-aminobutyric acid (GABA), an inhibitory neurotransmitter, which ends the GABA neurotransmission. Defects in this gene may result in epilepsy, behavioral problems, or intellectual problems. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted mutation display postnatal lethality. Mice heterozygous for a targeted mutation display resistance to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,137,722 S89P probably benign Het
Aatf A T 11: 84,470,676 M367K probably benign Het
Adam18 A T 8: 24,652,127 I211N probably damaging Het
Angpt1 T C 15: 42,427,034 Y478C probably damaging Het
Apba2 A T 7: 64,736,926 I434F probably damaging Het
Arfgef1 T A 1: 10,216,534 K50N probably benign Het
Arfgef2 A T 2: 166,873,983 Q1397H probably benign Het
Ascc2 G A 11: 4,647,208 R129Q probably damaging Het
Atxn1 A G 13: 45,566,556 V621A probably benign Het
Catsperz A T 19: 6,922,562 L192M probably benign Het
Cd5 G A 19: 10,720,221 P465S probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cfap61 A G 2: 145,947,183 E94G probably benign Het
Chd1 A G 17: 15,762,449 H1392R probably damaging Het
Csnk1a1 A G 18: 61,555,817 I23V probably benign Het
Ctnnd2 C T 15: 30,647,033 R292C probably benign Het
Dcaf6 T A 1: 165,388,675 H453L probably benign Het
Dnah3 C A 7: 120,011,030 D1728Y probably damaging Het
Dtx3 T C 10: 127,192,824 K179E possibly damaging Het
Fam3b T A 16: 97,481,853 Y74F probably benign Het
Gm5464 T C 14: 66,869,106 L64P unknown Het
Gm5624 T G 14: 44,561,890 N70T Het
Kcnh7 T A 2: 62,764,608 H706L probably damaging Het
Kdm2b C T 5: 122,880,176 R1067H probably damaging Het
Klhl28 A T 12: 64,950,090 H492Q probably damaging Het
Loxl3 T A 6: 83,050,624 C716S probably damaging Het
Ltbp2 A G 12: 84,786,413 Y1474H probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Mmp24 G T 2: 155,814,015 V458L probably benign Het
Mpl C A 4: 118,446,109 S502I Het
Nfatc1 A T 18: 80,667,042 V503D probably damaging Het
Nim1k A G 13: 119,714,271 I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 Y327C probably damaging Het
Olfr1214 T C 2: 88,988,065 T46A probably benign Het
Oma1 C T 4: 103,328,916 R360* probably null Het
Oog2 T A 4: 144,194,173 W59R probably damaging Het
Pcdh10 A G 3: 45,379,539 E96G probably damaging Het
Pcna T A 2: 132,251,930 T98S probably benign Het
Pcnx3 C T 19: 5,679,590 C899Y possibly damaging Het
Phf11d T C 14: 59,356,434 N97S probably benign Het
Plekhg4 G A 8: 105,377,329 W431* probably null Het
Plk4 A G 3: 40,813,466 T815A probably benign Het
Pnma2 C T 14: 66,916,313 T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 R548W probably damaging Het
Ptx3 A G 3: 66,224,780 S241G probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rplp0 A T 5: 115,560,764 K26N probably damaging Het
Sec62 A C 3: 30,818,782 E338A unknown Het
Sema6a T C 18: 47,248,955 M842V probably benign Het
Serpina3j T C 12: 104,314,784 V72A probably benign Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc29a4 A G 5: 142,720,125 N455D probably damaging Het
Spag6 G A 2: 18,710,583 V80M probably damaging Het
Spic T C 10: 88,678,636 E34G possibly damaging Het
Tecpr2 A G 12: 110,931,720 K469E possibly damaging Het
Them7 T A 2: 105,297,845 L57Q probably benign Het
Tlr3 G A 8: 45,396,941 A897V probably damaging Het
Tnp2 A G 16: 10,788,508 C32R possibly damaging Het
Trpm6 A T 19: 18,853,968 Q1399L probably benign Het
Ttn C A 2: 76,846,671 E11074* probably null Het
Ubash3b G A 9: 41,043,485 A243V probably benign Het
Vash1 G A 12: 86,680,178 R64Q possibly damaging Het
Vmn1r167 T A 7: 23,505,556 M12L possibly damaging Het
Vmn2r111 T A 17: 22,548,581 H645L probably benign Het
Vmn2r75 A T 7: 86,148,514 I697K probably damaging Het
Vmn2r87 A G 10: 130,472,257 I704T probably damaging Het
Other mutations in Slc6a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01306:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01308:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01616:Slc6a11 APN 6 114134868 missense possibly damaging 0.93
IGL01985:Slc6a11 APN 6 114134892 missense probably benign 0.43
IGL02270:Slc6a11 APN 6 114238396 missense probably damaging 1.00
IGL02692:Slc6a11 APN 6 114162139 missense probably damaging 1.00
IGL02828:Slc6a11 APN 6 114134987 missense possibly damaging 0.53
IGL03135:Slc6a11 APN 6 114194609 critical splice acceptor site probably null
ANU23:Slc6a11 UTSW 6 114134665 missense probably damaging 1.00
R0603:Slc6a11 UTSW 6 114244890 missense probably benign 0.03
R1147:Slc6a11 UTSW 6 114244870 missense possibly damaging 0.90
R1147:Slc6a11 UTSW 6 114244870 missense possibly damaging 0.90
R1219:Slc6a11 UTSW 6 114225811 splice site probably benign
R1226:Slc6a11 UTSW 6 114194663 missense possibly damaging 0.93
R1676:Slc6a11 UTSW 6 114247666 missense probably benign
R2231:Slc6a11 UTSW 6 114194629 missense probably damaging 1.00
R2297:Slc6a11 UTSW 6 114131425 missense probably benign 0.37
R4384:Slc6a11 UTSW 6 114247727 missense possibly damaging 0.47
R4556:Slc6a11 UTSW 6 114244812 missense probably benign 0.00
R4564:Slc6a11 UTSW 6 114131362 missense probably benign 0.00
R5488:Slc6a11 UTSW 6 114243894 missense probably damaging 1.00
R5736:Slc6a11 UTSW 6 114162162 missense probably damaging 1.00
R6021:Slc6a11 UTSW 6 114230051 missense probably damaging 1.00
R6150:Slc6a11 UTSW 6 114245618 missense probably benign 0.08
R6733:Slc6a11 UTSW 6 114134898 missense probably damaging 1.00
R7391:Slc6a11 UTSW 6 114238461 missense probably benign
R7451:Slc6a11 UTSW 6 114245683 nonsense probably null
R7750:Slc6a11 UTSW 6 114230137 missense possibly damaging 0.82
R8115:Slc6a11 UTSW 6 114131481 missense probably damaging 1.00
R8179:Slc6a11 UTSW 6 114245606 missense probably benign 0.01
R8512:Slc6a11 UTSW 6 114238441 missense probably damaging 1.00
R8774:Slc6a11 UTSW 6 114230034 splice site probably benign
R8963:Slc6a11 UTSW 6 114225821 critical splice acceptor site probably null
R9032:Slc6a11 UTSW 6 114225847 missense probably damaging 1.00
R9056:Slc6a11 UTSW 6 114243944 missense probably benign 0.00
R9085:Slc6a11 UTSW 6 114225847 missense probably damaging 1.00
R9407:Slc6a11 UTSW 6 114243953 missense probably damaging 1.00
Z1177:Slc6a11 UTSW 6 114247642 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACCATCCCGGGATTCAAGC -3'
(R):5'- TAAAATACCAGTGAGAGTGGCC -3'

Sequencing Primer
(F):5'- GAGCCTCTCAAAAGCCCGG -3'
(R):5'- TGGCCTGAAAGCAGAGCTC -3'
Posted On 2020-10-20