Mutagenetix > Incidental Mutation

Incidental Mutation 'R8411:Siglecf'

652677

Institutional Source

Beutler Lab

Gene Symbol

Siglecf

Ensembl Gene

ENSMUSG00000039013

Gene Name

sialic acid binding Ig-like lectin F

Synonyms

mSiglec-F, Siglec5

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43351341-43359531 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43351944 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 112 (F112S)

Ref Sequence

ENSEMBL: ENSMUSP00000146009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000012798] [ENSMUST00000121494] [ENSMUST00000122423] [ENSMUST00000206299]

AlphaFold

Q920G3

Predicted Effect

probably damaging
Transcript: ENSMUST00000012798
AA Change: F112S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000012798
Gene: ENSMUSG00000039013
AA Change: F112S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IG	25	131	6.07e-3	SMART
IG_like	142	226	4.91e1	SMART
IGc2	256	315	8.7e-13	SMART
transmembrane domain	440	462	N/A	INTRINSIC
low complexity region	486	500	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121494
AA Change: F112S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112583
Gene: ENSMUSG00000039013
AA Change: F112S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IG	25	131	6.07e-3	SMART
IG_like	142	226	4.91e1	SMART
IGc2	256	315	8.7e-13	SMART
Pfam:Ig_2	329	421	2.4e-3	PFAM
transmembrane domain	440	462	N/A	INTRINSIC
low complexity region	486	500	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000122423
AA Change: F112S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113245
Gene: ENSMUSG00000039013
AA Change: F112S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IG	25	131	6.07e-3	SMART
IG_like	142	226	4.91e1	SMART
IGc2	256	315	8.7e-13	SMART
Pfam:Ig_2	329	421	5.1e-4	PFAM
transmembrane domain	440	462	N/A	INTRINSIC
low complexity region	486	500	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125335

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145867

Predicted Effect

probably damaging
Transcript: ENSMUST00000206299
AA Change: F112S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.4584

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyrosine-based inhibitory motif, or ITIM (see MIM 604964), and a motif homologous to one identified in signaling lymphocyte activation molecule (SLAM; MIM 603492) that mediates an association with SLAM-associated protein (SAP; MIM 300490) (summarized by Foussias et al., 2000 [PubMed 11095983]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lung inflammation in response to ovalbumin challenge with increased eosinophils, delayed eosinophil resolution and impaired eosinophil apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,137,722	S89P	probably benign	Het
Aatf	A	T	11: 84,470,676	M367K	probably benign	Het
Adam18	A	T	8: 24,652,127	I211N	probably damaging	Het
Angpt1	T	C	15: 42,427,034	Y478C	probably damaging	Het
Apba2	A	T	7: 64,736,926	I434F	probably damaging	Het
Arfgef1	T	A	1: 10,216,534	K50N	probably benign	Het
Arfgef2	A	T	2: 166,873,983	Q1397H	probably benign	Het
Ascc2	G	A	11: 4,647,208	R129Q	probably damaging	Het
Atxn1	A	G	13: 45,566,556	V621A	probably benign	Het
Catsperz	A	T	19: 6,922,562	L192M	probably benign	Het
Cd5	G	A	19: 10,720,221	P465S	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cfap61	A	G	2: 145,947,183	E94G	probably benign	Het
Chd1	A	G	17: 15,762,449	H1392R	probably damaging	Het
Csnk1a1	A	G	18: 61,555,817	I23V	probably benign	Het
Ctnnd2	C	T	15: 30,647,033	R292C	probably benign	Het
Dcaf6	T	A	1: 165,388,675	H453L	probably benign	Het
Dnah3	C	A	7: 120,011,030	D1728Y	probably damaging	Het
Dtx3	T	C	10: 127,192,824	K179E	possibly damaging	Het
Fam3b	T	A	16: 97,481,853	Y74F	probably benign	Het
Gm5464	T	C	14: 66,869,106	L64P	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Kcnh7	T	A	2: 62,764,608	H706L	probably damaging	Het
Kdm2b	C	T	5: 122,880,176	R1067H	probably damaging	Het
Klhl28	A	T	12: 64,950,090	H492Q	probably damaging	Het
Loxl3	T	A	6: 83,050,624	C716S	probably damaging	Het
Ltbp2	A	G	12: 84,786,413	Y1474H	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Mmp24	G	T	2: 155,814,015	V458L	probably benign	Het
Mpl	C	A	4: 118,446,109	S502I		Het
Nfatc1	A	T	18: 80,667,042	V503D	probably damaging	Het
Nim1k	A	G	13: 119,714,271	I133T	possibly damaging	Het
Nr1d2	T	C	14: 18,215,031	Y327C	probably damaging	Het
Olfr1214	T	C	2: 88,988,065	T46A	probably benign	Het
Oma1	C	T	4: 103,328,916	R360*	probably null	Het
Oog2	T	A	4: 144,194,173	W59R	probably damaging	Het
Pcdh10	A	G	3: 45,379,539	E96G	probably damaging	Het
Pcna	T	A	2: 132,251,930	T98S	probably benign	Het
Pcnx3	C	T	19: 5,679,590	C899Y	possibly damaging	Het
Phf11d	T	C	14: 59,356,434	N97S	probably benign	Het
Plekhg4	G	A	8: 105,377,329	W431*	probably null	Het
Plk4	A	G	3: 40,813,466	T815A	probably benign	Het
Pnma2	C	T	14: 66,916,313	T62I	possibly damaging	Het
Ppp1r9a	C	T	6: 5,057,568	R548W	probably damaging	Het
Ptx3	A	G	3: 66,224,780	S241G	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rplp0	A	T	5: 115,560,764	K26N	probably damaging	Het
Sec62	A	C	3: 30,818,782	E338A	unknown	Het
Sema6a	T	C	18: 47,248,955	M842V	probably benign	Het
Serpina3j	T	C	12: 104,314,784	V72A	probably benign	Het
Slc29a4	A	G	5: 142,720,125	N455D	probably damaging	Het
Slc6a11	T	A	6: 114,131,437	F54Y	probably benign	Het
Spag6	G	A	2: 18,710,583	V80M	probably damaging	Het
Spic	T	C	10: 88,678,636	E34G	possibly damaging	Het
Tecpr2	A	G	12: 110,931,720	K469E	possibly damaging	Het
Them7	T	A	2: 105,297,845	L57Q	probably benign	Het
Tlr3	G	A	8: 45,396,941	A897V	probably damaging	Het
Tnp2	A	G	16: 10,788,508	C32R	possibly damaging	Het
Trpm6	A	T	19: 18,853,968	Q1399L	probably benign	Het
Ttn	C	A	2: 76,846,671	E11074*	probably null	Het
Ubash3b	G	A	9: 41,043,485	A243V	probably benign	Het
Vash1	G	A	12: 86,680,178	R64Q	possibly damaging	Het
Vmn1r167	T	A	7: 23,505,556	M12L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,581	H645L	probably benign	Het
Vmn2r75	A	T	7: 86,148,514	I697K	probably damaging	Het
Vmn2r87	A	G	10: 130,472,257	I704T	probably damaging	Het

Other mutations in Siglecf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Siglecf	APN	7	43351953	nonsense	probably null
IGL01350:Siglecf	APN	7	43355895	intron	probably benign
IGL01458:Siglecf	APN	7	43355138	missense	possibly damaging	0.46
IGL01582:Siglecf	APN	7	43358721	missense	possibly damaging	0.55
IGL02347:Siglecf	APN	7	43351721	missense	possibly damaging	0.78
IGL02530:Siglecf	APN	7	43352210	missense	probably benign	0.07
IGL02700:Siglecf	APN	7	43352378	missense	probably damaging	1.00
IGL03093:Siglecf	APN	7	43352441	missense	probably damaging	1.00
IGL03178:Siglecf	APN	7	43358739	missense	probably damaging	0.98
IGL03280:Siglecf	APN	7	43355930	missense	probably benign	0.04
ANU23:Siglecf	UTSW	7	43351953	nonsense	probably null
R0003:Siglecf	UTSW	7	43355926	missense	probably benign
R0025:Siglecf	UTSW	7	43351925	missense	probably benign	0.29
R0304:Siglecf	UTSW	7	43352401	missense	probably damaging	1.00
R0345:Siglecf	UTSW	7	43351944	missense	probably damaging	1.00
R0395:Siglecf	UTSW	7	43355975	missense	probably damaging	1.00
R0515:Siglecf	UTSW	7	43355631	critical splice donor site	probably null
R1296:Siglecf	UTSW	7	43355920	nonsense	probably null
R1861:Siglecf	UTSW	7	43352224	missense	probably benign	0.00
R1861:Siglecf	UTSW	7	43355543	missense	probably benign	0.01
R1869:Siglecf	UTSW	7	43355543	missense	probably benign	0.01
R1870:Siglecf	UTSW	7	43355543	missense	probably benign	0.01
R1871:Siglecf	UTSW	7	43355543	missense	probably benign	0.01
R2063:Siglecf	UTSW	7	43352380	missense	possibly damaging	0.79
R2176:Siglecf	UTSW	7	43351716	missense	probably damaging	0.98
R2237:Siglecf	UTSW	7	43354985	missense	probably benign	0.06
R4023:Siglecf	UTSW	7	43355571	missense	possibly damaging	0.56
R4498:Siglecf	UTSW	7	43352276	missense	possibly damaging	0.47
R4664:Siglecf	UTSW	7	43356413	missense	possibly damaging	0.75
R5227:Siglecf	UTSW	7	43351940	missense	probably damaging	1.00
R5315:Siglecf	UTSW	7	43355108	missense	probably benign	0.01
R5763:Siglecf	UTSW	7	43356320	nonsense	probably null
R5828:Siglecf	UTSW	7	43351713	missense	probably damaging	1.00
R5871:Siglecf	UTSW	7	43355621	missense	probably benign	0.04
R5952:Siglecf	UTSW	7	43355927	missense	probably benign	0.00
R6054:Siglecf	UTSW	7	43355006	missense	probably damaging	1.00
R6537:Siglecf	UTSW	7	43355999	missense	probably benign
R6854:Siglecf	UTSW	7	43352180	missense	probably benign	0.00
R6875:Siglecf	UTSW	7	43355200	missense	probably benign	0.04
R7328:Siglecf	UTSW	7	43352267	missense	possibly damaging	0.92
R7329:Siglecf	UTSW	7	43351971	missense	probably damaging	1.00
R7356:Siglecf	UTSW	7	43356431	missense	probably benign	0.00
R7369:Siglecf	UTSW	7	43351817	missense	probably damaging	0.99
R7659:Siglecf	UTSW	7	43351770	missense	probably damaging	1.00
R7984:Siglecf	UTSW	7	43355231	splice site	probably null
R8074:Siglecf	UTSW	7	43351790	missense	possibly damaging	0.93
R8686:Siglecf	UTSW	7	43355606	missense	probably benign	0.31
R8724:Siglecf	UTSW	7	43355552	missense	probably damaging	1.00
R8962:Siglecf	UTSW	7	43351716	missense	probably damaging	1.00
R9480:Siglecf	UTSW	7	43352242	missense	possibly damaging	0.79
R9572:Siglecf	UTSW	7	43352634	missense	possibly damaging	0.83
R9592:Siglecf	UTSW	7	43352272	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTGTAGCCTGCCAAGTCC -3'
(R):5'- ACCCTATTTCAAGCCAGGCTTC -3'

Sequencing Primer
(F):5'- TGTAGCCTGCCAAGTCCAGTAC -3'
(R):5'- AGCCAGGCTTCTCTCCCAAC -3'

Posted On

2020-10-20