Mutagenetix > Incidental Mutation

Incidental Mutation 'R8411:Apba2'

652678

Institutional Source

Beutler Lab

Gene Symbol

Apba2

Ensembl Gene

ENSMUSG00000030519

Gene Name

amyloid beta (A4) precursor protein-binding, family A, member 2

Synonyms

X11L, X11-like, Mint 2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.231) question?

Stock #

R8411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64501706-64753878 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64736926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 434 (I434F)

Ref Sequence

ENSEMBL: ENSMUSP00000032732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032732] [ENSMUST00000206246]

AlphaFold

P98084

Predicted Effect

probably damaging
Transcript: ENSMUST00000032732
AA Change: I434F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000032732
Gene: ENSMUSG00000030519
AA Change: I434F

Domain	Start	End	E-Value	Type
low complexity region	82	96	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
PTB	368	534	6.31e-29	SMART
PDZ	578	656	6.32e-12	SMART
PDZ	670	736	1.79e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000206246
AA Change: I422F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show a selective deficit in motivated approach behavior, but not in motivated avoidance behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,137,722	S89P	probably benign	Het
Aatf	A	T	11: 84,470,676	M367K	probably benign	Het
Adam18	A	T	8: 24,652,127	I211N	probably damaging	Het
Angpt1	T	C	15: 42,427,034	Y478C	probably damaging	Het
Arfgef1	T	A	1: 10,216,534	K50N	probably benign	Het
Arfgef2	A	T	2: 166,873,983	Q1397H	probably benign	Het
Ascc2	G	A	11: 4,647,208	R129Q	probably damaging	Het
Atxn1	A	G	13: 45,566,556	V621A	probably benign	Het
Catsperz	A	T	19: 6,922,562	L192M	probably benign	Het
Cd5	G	A	19: 10,720,221	P465S	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cfap61	A	G	2: 145,947,183	E94G	probably benign	Het
Chd1	A	G	17: 15,762,449	H1392R	probably damaging	Het
Csnk1a1	A	G	18: 61,555,817	I23V	probably benign	Het
Ctnnd2	C	T	15: 30,647,033	R292C	probably benign	Het
Dcaf6	T	A	1: 165,388,675	H453L	probably benign	Het
Dnah3	C	A	7: 120,011,030	D1728Y	probably damaging	Het
Dtx3	T	C	10: 127,192,824	K179E	possibly damaging	Het
Fam3b	T	A	16: 97,481,853	Y74F	probably benign	Het
Gm5464	T	C	14: 66,869,106	L64P	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Kcnh7	T	A	2: 62,764,608	H706L	probably damaging	Het
Kdm2b	C	T	5: 122,880,176	R1067H	probably damaging	Het
Klhl28	A	T	12: 64,950,090	H492Q	probably damaging	Het
Loxl3	T	A	6: 83,050,624	C716S	probably damaging	Het
Ltbp2	A	G	12: 84,786,413	Y1474H	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Mmp24	G	T	2: 155,814,015	V458L	probably benign	Het
Mpl	C	A	4: 118,446,109	S502I		Het
Nfatc1	A	T	18: 80,667,042	V503D	probably damaging	Het
Nim1k	A	G	13: 119,714,271	I133T	possibly damaging	Het
Nr1d2	T	C	14: 18,215,031	Y327C	probably damaging	Het
Olfr1214	T	C	2: 88,988,065	T46A	probably benign	Het
Oma1	C	T	4: 103,328,916	R360*	probably null	Het
Oog2	T	A	4: 144,194,173	W59R	probably damaging	Het
Pcdh10	A	G	3: 45,379,539	E96G	probably damaging	Het
Pcna	T	A	2: 132,251,930	T98S	probably benign	Het
Pcnx3	C	T	19: 5,679,590	C899Y	possibly damaging	Het
Phf11d	T	C	14: 59,356,434	N97S	probably benign	Het
Plekhg4	G	A	8: 105,377,329	W431*	probably null	Het
Plk4	A	G	3: 40,813,466	T815A	probably benign	Het
Pnma2	C	T	14: 66,916,313	T62I	possibly damaging	Het
Ppp1r9a	C	T	6: 5,057,568	R548W	probably damaging	Het
Ptx3	A	G	3: 66,224,780	S241G	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rplp0	A	T	5: 115,560,764	K26N	probably damaging	Het
Sec62	A	C	3: 30,818,782	E338A	unknown	Het
Sema6a	T	C	18: 47,248,955	M842V	probably benign	Het
Serpina3j	T	C	12: 104,314,784	V72A	probably benign	Het
Siglecf	T	C	7: 43,351,944	F112S	probably damaging	Het
Slc29a4	A	G	5: 142,720,125	N455D	probably damaging	Het
Slc6a11	T	A	6: 114,131,437	F54Y	probably benign	Het
Spag6	G	A	2: 18,710,583	V80M	probably damaging	Het
Spic	T	C	10: 88,678,636	E34G	possibly damaging	Het
Tecpr2	A	G	12: 110,931,720	K469E	possibly damaging	Het
Them7	T	A	2: 105,297,845	L57Q	probably benign	Het
Tlr3	G	A	8: 45,396,941	A897V	probably damaging	Het
Tnp2	A	G	16: 10,788,508	C32R	possibly damaging	Het
Trpm6	A	T	19: 18,853,968	Q1399L	probably benign	Het
Ttn	C	A	2: 76,846,671	E11074*	probably null	Het
Ubash3b	G	A	9: 41,043,485	A243V	probably benign	Het
Vash1	G	A	12: 86,680,178	R64Q	possibly damaging	Het
Vmn1r167	T	A	7: 23,505,556	M12L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,581	H645L	probably benign	Het
Vmn2r75	A	T	7: 86,148,514	I697K	probably damaging	Het
Vmn2r87	A	G	10: 130,472,257	I704T	probably damaging	Het

Other mutations in Apba2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Apba2	APN	7	64736941	missense	possibly damaging	0.79
IGL01716:Apba2	APN	7	64745826	splice site	probably benign
IGL02218:Apba2	APN	7	64695677	missense	probably benign	0.01
IGL02343:Apba2	APN	7	64695146	missense	probably damaging	0.96
IGL03265:Apba2	APN	7	64695323	missense	probably damaging	1.00
guadalupe	UTSW	7	64750164	missense	probably damaging	1.00
LCD18:Apba2	UTSW	7	64622160	intron	probably benign
R0395:Apba2	UTSW	7	64743408	missense	probably benign	0.00
R0554:Apba2	UTSW	7	64745780	missense	probably damaging	1.00
R0624:Apba2	UTSW	7	64714515	splice site	probably null
R0733:Apba2	UTSW	7	64750164	missense	probably damaging	1.00
R1107:Apba2	UTSW	7	64745719	missense	possibly damaging	0.51
R1464:Apba2	UTSW	7	64695549	missense	probably benign
R1464:Apba2	UTSW	7	64695549	missense	probably benign
R1486:Apba2	UTSW	7	64736948	missense	probably damaging	1.00
R1895:Apba2	UTSW	7	64744630	critical splice donor site	probably null
R1942:Apba2	UTSW	7	64695470	missense	possibly damaging	0.92
R1946:Apba2	UTSW	7	64744630	critical splice donor site	probably null
R2002:Apba2	UTSW	7	64733542	missense	probably damaging	0.97
R2089:Apba2	UTSW	7	64695593	missense	probably benign	0.02
R2091:Apba2	UTSW	7	64695593	missense	probably benign	0.02
R2091:Apba2	UTSW	7	64695593	missense	probably benign	0.02
R2571:Apba2	UTSW	7	64745750	missense	probably damaging	0.98
R3035:Apba2	UTSW	7	64739792	missense	probably benign	0.03
R4620:Apba2	UTSW	7	64714467	missense	probably damaging	1.00
R5468:Apba2	UTSW	7	64745762	missense	probably damaging	1.00
R5478:Apba2	UTSW	7	64695186	nonsense	probably null
R5644:Apba2	UTSW	7	64715511	missense	probably benign
R5645:Apba2	UTSW	7	64695806	missense	possibly damaging	0.92
R5941:Apba2	UTSW	7	64745716	missense	probably benign	0.03
R5969:Apba2	UTSW	7	64744447	nonsense	probably null
R6190:Apba2	UTSW	7	64739880	missense	probably damaging	0.98
R6806:Apba2	UTSW	7	64695459	missense	probably damaging	1.00
R7098:Apba2	UTSW	7	64736948	missense	probably damaging	1.00
R7143:Apba2	UTSW	7	64744417	missense	probably damaging	1.00
R7183:Apba2	UTSW	7	64733545	missense	probably benign	0.11
R7260:Apba2	UTSW	7	64739745	missense	probably damaging	1.00
R7479:Apba2	UTSW	7	64739859	missense	possibly damaging	0.63
R7677:Apba2	UTSW	7	64695097	missense	probably benign	0.02
R7959:Apba2	UTSW	7	64695823	missense	probably benign
R8325:Apba2	UTSW	7	64695982	missense	probably benign	0.02
R8376:Apba2	UTSW	7	64695593	missense	probably benign	0.02
R8412:Apba2	UTSW	7	64745798	missense	probably damaging	1.00
R8857:Apba2	UTSW	7	64750191	missense	possibly damaging	0.76
R9040:Apba2	UTSW	7	64743324	missense	possibly damaging	0.82
R9265:Apba2	UTSW	7	64743272	missense	probably damaging	0.99
R9356:Apba2	UTSW	7	64695673	missense	probably damaging	1.00
R9569:Apba2	UTSW	7	64743390	missense	possibly damaging	0.64
R9667:Apba2	UTSW	7	64695314	missense	possibly damaging	0.67
Z1177:Apba2	UTSW	7	64750235	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- CTGTGCTCTGGGCCTTTAGAAG -3'
(R):5'- CCCTGACAGTGACAGATAAGC -3'

Sequencing Primer
(F):5'- GGAATTCCTCACCAAGCAAACAGG -3'
(R):5'- CAAAAGTGCCCTTCCCCTGG -3'

Posted On

2020-10-20