Incidental Mutation 'R8411:Vmn2r75'
ID 652679
Institutional Source Beutler Lab
Gene Symbol Vmn2r75
Ensembl Gene ENSMUSG00000090436
Gene Name vomeronasal 2, receptor 75
Synonyms EG546981
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 85797250-85820932 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85797722 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 697 (I697K)
Ref Sequence ENSEMBL: ENSMUSP00000126973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167830]
AlphaFold G5E8Z7
Predicted Effect probably damaging
Transcript: ENSMUST00000167830
AA Change: I697K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: I697K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 80 466 2.8e-31 PFAM
Pfam:NCD3G 510 562 4.6e-20 PFAM
Pfam:7tm_3 593 829 7.7e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Vmn2r75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Vmn2r75 APN 7 85,797,240 (GRCm39) unclassified probably benign
IGL01287:Vmn2r75 APN 7 85,797,801 (GRCm39) missense probably damaging 0.97
IGL01318:Vmn2r75 APN 7 85,814,774 (GRCm39) missense probably benign 0.06
IGL01331:Vmn2r75 APN 7 85,820,870 (GRCm39) nonsense probably null
IGL01406:Vmn2r75 APN 7 85,812,500 (GRCm39) splice site probably benign
IGL01615:Vmn2r75 APN 7 85,797,681 (GRCm39) missense probably benign 0.03
IGL01657:Vmn2r75 APN 7 85,813,455 (GRCm39) missense probably damaging 1.00
IGL02237:Vmn2r75 APN 7 85,814,786 (GRCm39) missense possibly damaging 0.88
IGL02275:Vmn2r75 APN 7 85,814,348 (GRCm39) missense probably benign 0.04
IGL02307:Vmn2r75 APN 7 85,814,974 (GRCm39) missense probably benign 0.00
IGL03136:Vmn2r75 APN 7 85,797,911 (GRCm39) missense possibly damaging 0.89
IGL03160:Vmn2r75 APN 7 85,797,644 (GRCm39) missense probably damaging 1.00
IGL03244:Vmn2r75 APN 7 85,820,933 (GRCm39) unclassified probably benign
PIT4449001:Vmn2r75 UTSW 7 85,814,791 (GRCm39) missense probably damaging 1.00
R0049:Vmn2r75 UTSW 7 85,797,309 (GRCm39) nonsense probably null
R0049:Vmn2r75 UTSW 7 85,797,309 (GRCm39) nonsense probably null
R0083:Vmn2r75 UTSW 7 85,814,866 (GRCm39) missense probably benign 0.00
R0108:Vmn2r75 UTSW 7 85,814,866 (GRCm39) missense probably benign 0.00
R0276:Vmn2r75 UTSW 7 85,797,515 (GRCm39) missense probably benign 0.01
R0320:Vmn2r75 UTSW 7 85,814,288 (GRCm39) missense probably benign 0.36
R0471:Vmn2r75 UTSW 7 85,814,721 (GRCm39) missense probably benign 0.01
R0562:Vmn2r75 UTSW 7 85,797,449 (GRCm39) nonsense probably null
R0631:Vmn2r75 UTSW 7 85,812,478 (GRCm39) missense probably null 1.00
R0661:Vmn2r75 UTSW 7 85,814,866 (GRCm39) missense probably benign 0.00
R0811:Vmn2r75 UTSW 7 85,814,575 (GRCm39) missense probably benign 0.38
R0812:Vmn2r75 UTSW 7 85,814,575 (GRCm39) missense probably benign 0.38
R0891:Vmn2r75 UTSW 7 85,813,476 (GRCm39) missense possibly damaging 0.81
R1340:Vmn2r75 UTSW 7 85,797,798 (GRCm39) missense probably damaging 0.98
R1501:Vmn2r75 UTSW 7 85,814,850 (GRCm39) missense possibly damaging 0.85
R1760:Vmn2r75 UTSW 7 85,798,019 (GRCm39) missense probably damaging 1.00
R1970:Vmn2r75 UTSW 7 85,797,470 (GRCm39) missense probably damaging 1.00
R2060:Vmn2r75 UTSW 7 85,814,372 (GRCm39) missense probably benign 0.00
R2292:Vmn2r75 UTSW 7 85,798,144 (GRCm39) missense probably damaging 1.00
R3688:Vmn2r75 UTSW 7 85,797,629 (GRCm39) missense probably damaging 0.99
R3892:Vmn2r75 UTSW 7 85,813,494 (GRCm39) missense probably null 1.00
R4532:Vmn2r75 UTSW 7 85,797,349 (GRCm39) nonsense probably null
R4583:Vmn2r75 UTSW 7 85,813,290 (GRCm39) missense possibly damaging 0.81
R4592:Vmn2r75 UTSW 7 85,815,494 (GRCm39) missense probably benign 0.00
R4792:Vmn2r75 UTSW 7 85,812,378 (GRCm39) missense possibly damaging 0.46
R4859:Vmn2r75 UTSW 7 85,797,611 (GRCm39) missense probably benign 0.35
R4896:Vmn2r75 UTSW 7 85,820,787 (GRCm39) missense probably benign 0.01
R4943:Vmn2r75 UTSW 7 85,814,705 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r75 UTSW 7 85,815,375 (GRCm39) critical splice donor site probably null
R5048:Vmn2r75 UTSW 7 85,814,735 (GRCm39) missense possibly damaging 0.66
R5063:Vmn2r75 UTSW 7 85,813,372 (GRCm39) missense probably benign
R5156:Vmn2r75 UTSW 7 85,813,436 (GRCm39) missense possibly damaging 0.51
R5243:Vmn2r75 UTSW 7 85,813,447 (GRCm39) missense probably damaging 1.00
R5277:Vmn2r75 UTSW 7 85,815,500 (GRCm39) missense probably benign
R5574:Vmn2r75 UTSW 7 85,815,510 (GRCm39) missense probably benign 0.22
R5622:Vmn2r75 UTSW 7 85,797,702 (GRCm39) missense probably benign 0.15
R5680:Vmn2r75 UTSW 7 85,820,779 (GRCm39) missense probably benign 0.10
R5884:Vmn2r75 UTSW 7 85,814,578 (GRCm39) missense probably benign
R6021:Vmn2r75 UTSW 7 85,820,820 (GRCm39) missense probably benign 0.01
R6217:Vmn2r75 UTSW 7 85,815,375 (GRCm39) critical splice donor site probably benign
R6242:Vmn2r75 UTSW 7 85,814,592 (GRCm39) missense probably damaging 1.00
R6299:Vmn2r75 UTSW 7 85,814,482 (GRCm39) missense probably benign 0.12
R6441:Vmn2r75 UTSW 7 85,820,784 (GRCm39) missense probably damaging 0.99
R6495:Vmn2r75 UTSW 7 85,813,287 (GRCm39) missense probably benign 0.00
R6553:Vmn2r75 UTSW 7 85,813,453 (GRCm39) missense probably benign 0.28
R6670:Vmn2r75 UTSW 7 85,797,644 (GRCm39) missense probably damaging 1.00
R7078:Vmn2r75 UTSW 7 85,815,568 (GRCm39) missense probably damaging 1.00
R7164:Vmn2r75 UTSW 7 85,814,592 (GRCm39) missense probably damaging 1.00
R8507:Vmn2r75 UTSW 7 85,797,685 (GRCm39) nonsense probably null
R8559:Vmn2r75 UTSW 7 85,815,480 (GRCm39) missense possibly damaging 0.65
R8677:Vmn2r75 UTSW 7 85,814,410 (GRCm39) missense possibly damaging 0.86
R8708:Vmn2r75 UTSW 7 85,812,476 (GRCm39) missense probably damaging 0.99
R8778:Vmn2r75 UTSW 7 85,813,497 (GRCm39) missense probably benign 0.40
R8968:Vmn2r75 UTSW 7 85,820,765 (GRCm39) nonsense probably null
R9145:Vmn2r75 UTSW 7 85,813,447 (GRCm39) missense probably damaging 1.00
R9316:Vmn2r75 UTSW 7 85,797,313 (GRCm39) missense possibly damaging 0.63
R9363:Vmn2r75 UTSW 7 85,815,423 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTATCAGGCAGTTTCCTCGAC -3'
(R):5'- GCTTTACATTGGTCATCCCACTATG -3'

Sequencing Primer
(F):5'- GTTTCCTCGACAAGAAAGCTACAGTG -3'
(R):5'- GTTCATCTGTATTCTGCAACAGACTG -3'
Posted On 2020-10-20