Incidental Mutation 'R0319:Ttll9'
ID65268
Institutional Source Beutler Lab
Gene Symbol Ttll9
Ensembl Gene ENSMUSG00000074673
Gene Nametubulin tyrosine ligase-like family, member 9
Synonyms4930509O20Rik, 1700016F23Rik
MMRRC Submission 038529-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0319 (G1)
Quality Score157
Status Validated
Chromosome2
Chromosomal Location152962485-153008482 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 153000098 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099197] [ENSMUST00000103155] [ENSMUST00000109801] [ENSMUST00000146626] [ENSMUST00000152158] [ENSMUST00000165343]
Predicted Effect probably null
Transcript: ENSMUST00000099197
SMART Domains Protein: ENSMUSP00000096803
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 69 397 2.2e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103155
SMART Domains Protein: ENSMUSP00000099444
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 67 397 5.3e-88 PFAM
low complexity region 452 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109801
SMART Domains Protein: ENSMUSP00000105426
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 68 222 4.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151641
Predicted Effect probably benign
Transcript: ENSMUST00000152158
Predicted Effect probably benign
Transcript: ENSMUST00000165343
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,237,190 V77G probably benign Het
Abcb1b A G 5: 8,827,428 R663G probably benign Het
Acly A G 11: 100,504,982 V404A probably damaging Het
Actg2 T A 6: 83,520,743 I103F probably damaging Het
Anapc5 A G 5: 122,818,856 V120A probably damaging Het
Ankk1 T G 9: 49,416,071 T603P probably damaging Het
Ankmy2 T C 12: 36,165,899 S33P possibly damaging Het
Arhgef19 A T 4: 141,256,399 T748S possibly damaging Het
Atad5 T A 11: 80,120,790 probably benign Het
Atxn10 T C 15: 85,365,282 L105P probably damaging Het
Cacna1s T C 1: 136,070,717 V161A probably damaging Het
Col6a3 T C 1: 90,807,704 E741G possibly damaging Het
Cpne9 G A 6: 113,294,693 G338E probably damaging Het
Cyp3a13 G A 5: 137,898,862 P397S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dirc2 T C 16: 35,750,514 D140G probably benign Het
Draxin A G 4: 148,115,972 L7P probably benign Het
Exosc7 T A 9: 123,130,960 probably benign Het
Far2 A G 6: 148,157,470 E218G probably damaging Het
Ggps1 A C 13: 14,053,877 N240K possibly damaging Het
Kcnip1 T C 11: 33,651,529 probably benign Het
Kcnv2 A T 19: 27,324,024 Y425F probably benign Het
Kdelr2 T A 5: 143,412,517 F40I probably damaging Het
Kdm1b C T 13: 47,053,719 P173L probably benign Het
Kif20b G A 19: 34,947,732 probably benign Het
Klhl9 A T 4: 88,720,454 Y517N possibly damaging Het
Lgals3bp A G 11: 118,393,521 S411P probably damaging Het
Lmo3 G A 6: 138,377,311 T85M probably damaging Het
Lvrn C A 18: 46,864,753 T256N probably damaging Het
Malt1 T C 18: 65,462,915 probably null Het
Mgst1 A G 6: 138,156,157 I157V possibly damaging Het
Mob3a A T 10: 80,689,985 V164E possibly damaging Het
Mprip T A 11: 59,697,038 probably benign Het
Mst1 A G 9: 108,082,513 N276S probably benign Het
Olfr1437 A T 19: 12,322,316 C170* probably null Het
P3h2 T A 16: 25,970,931 I529F possibly damaging Het
Pikfyve T A 1: 65,246,331 S865T probably benign Het
Rcbtb2 G A 14: 73,178,469 R474Q probably benign Het
Rpl27 G A 11: 101,443,495 probably benign Het
Rtp1 G A 16: 23,431,460 E192K probably damaging Het
Sgk2 T C 2: 162,995,672 probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Spdl1 T C 11: 34,823,520 N114S possibly damaging Het
Syne2 C T 12: 76,064,162 R5756W probably damaging Het
Tor1aip1 T C 1: 156,007,181 E307G probably damaging Het
Tpd52 T C 3: 8,953,689 T44A probably benign Het
Trim67 A T 8: 124,823,227 Y532F probably damaging Het
Ush2a T C 1: 188,948,374 probably benign Het
Vcam1 T C 3: 116,116,060 I539M probably benign Het
Vmn1r19 T A 6: 57,404,615 M51K possibly damaging Het
Vmn2r61 T A 7: 42,300,517 M787K probably damaging Het
Xdh T A 17: 73,906,101 probably benign Het
Zfp109 A T 7: 24,234,470 V8E probably damaging Het
Zfp595 G A 13: 67,316,513 A562V possibly damaging Het
Zfp759 A G 13: 67,140,292 T636A probably benign Het
Other mutations in Ttll9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Ttll9 APN 2 152984260 missense probably damaging 0.99
IGL01107:Ttll9 APN 2 153002889 splice site probably benign
IGL01365:Ttll9 APN 2 153000134 missense possibly damaging 0.87
IGL01751:Ttll9 APN 2 152983105 missense probably damaging 0.99
IGL02264:Ttll9 APN 2 153000135 missense probably damaging 1.00
IGL02477:Ttll9 APN 2 153000197 missense possibly damaging 0.77
IGL02899:Ttll9 APN 2 153002951 missense probably damaging 0.99
I2288:Ttll9 UTSW 2 152972339 splice site probably benign
R0053:Ttll9 UTSW 2 152962506 utr 5 prime probably benign
R0116:Ttll9 UTSW 2 152983134 missense probably damaging 0.99
R0388:Ttll9 UTSW 2 153000179 missense probably benign
R0556:Ttll9 UTSW 2 152973606 critical splice donor site probably null
R0689:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R1829:Ttll9 UTSW 2 153000236 missense possibly damaging 0.61
R2016:Ttll9 UTSW 2 153002294 missense probably damaging 1.00
R2144:Ttll9 UTSW 2 153003007 missense probably benign
R2229:Ttll9 UTSW 2 152983063 missense probably damaging 0.98
R2309:Ttll9 UTSW 2 152984145 missense probably damaging 1.00
R2314:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R4191:Ttll9 UTSW 2 153003007 missense probably benign
R4539:Ttll9 UTSW 2 152994091 missense probably damaging 1.00
R4866:Ttll9 UTSW 2 153003000 missense probably benign 0.02
R5115:Ttll9 UTSW 2 152989590 intron probably benign
R5279:Ttll9 UTSW 2 152962544 missense possibly damaging 0.80
R5342:Ttll9 UTSW 2 152991652 missense possibly damaging 0.87
R5375:Ttll9 UTSW 2 152984224 missense probably benign 0.13
R5417:Ttll9 UTSW 2 153002992 missense probably benign
R5555:Ttll9 UTSW 2 152990100 critical splice donor site probably null
R5574:Ttll9 UTSW 2 152984248 missense possibly damaging 0.90
R5598:Ttll9 UTSW 2 152984314 missense probably damaging 1.00
R5613:Ttll9 UTSW 2 152973601 frame shift probably null
R6366:Ttll9 UTSW 2 152991605 missense probably damaging 0.99
R6409:Ttll9 UTSW 2 152999341 missense probably damaging 1.00
R6655:Ttll9 UTSW 2 153000303 splice site probably null
R6657:Ttll9 UTSW 2 152984262 missense probably damaging 1.00
R6766:Ttll9 UTSW 2 152999300 nonsense probably null
R7012:Ttll9 UTSW 2 153003062 missense possibly damaging 0.46
R7162:Ttll9 UTSW 2 152989603 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGTCCCTTACTGGTCAACCAACC -3'
(R):5'- TACGGCTTGAGGTCCTGGTCAATG -3'

Sequencing Primer
(F):5'- accatctgttatcatatctacctacc -3'
(R):5'- CCTGGTCAATGAGGATGTCATAG -3'
Posted On2013-08-08