Mutagenetix > Incidental Mutation

Incidental Mutation 'R8411:Dnah3'

652680

Institutional Source

Beutler Lab

Gene Symbol

Dnah3

Ensembl Gene

ENSMUSG00000052273

Gene Name

dynein, axonemal, heavy chain 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R8411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119922671-120095280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 120011030 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 1728 (D1728Y)

Ref Sequence

ENSEMBL: ENSMUSP00000042857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046993
AA Change: D1728Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: D1728Y

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	805	820	N/A	INTRINSIC
Pfam:DHC_N2	826	1235	3.3e-144	PFAM
AAA	1388	1527	1.59e-1	SMART
low complexity region	1594	1606	N/A	INTRINSIC
Blast:AAA	1669	1897	9e-84	BLAST
AAA	2033	2180	1.33e-3	SMART
Pfam:AAA_8	2362	2632	1.5e-63	PFAM
Pfam:MT	2644	2994	7.4e-52	PFAM
Pfam:AAA_9	3015	3240	3.5e-92	PFAM
low complexity region	3338	3349	N/A	INTRINSIC
Pfam:Dynein_heavy	3376	4079	4.4e-285	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000209154
AA Change: D1717Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000213149

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,137,722	S89P	probably benign	Het
Aatf	A	T	11: 84,470,676	M367K	probably benign	Het
Adam18	A	T	8: 24,652,127	I211N	probably damaging	Het
Angpt1	T	C	15: 42,427,034	Y478C	probably damaging	Het
Apba2	A	T	7: 64,736,926	I434F	probably damaging	Het
Arfgef1	T	A	1: 10,216,534	K50N	probably benign	Het
Arfgef2	A	T	2: 166,873,983	Q1397H	probably benign	Het
Ascc2	G	A	11: 4,647,208	R129Q	probably damaging	Het
Atxn1	A	G	13: 45,566,556	V621A	probably benign	Het
Catsperz	A	T	19: 6,922,562	L192M	probably benign	Het
Cd5	G	A	19: 10,720,221	P465S	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cfap61	A	G	2: 145,947,183	E94G	probably benign	Het
Chd1	A	G	17: 15,762,449	H1392R	probably damaging	Het
Csnk1a1	A	G	18: 61,555,817	I23V	probably benign	Het
Ctnnd2	C	T	15: 30,647,033	R292C	probably benign	Het
Dcaf6	T	A	1: 165,388,675	H453L	probably benign	Het
Dtx3	T	C	10: 127,192,824	K179E	possibly damaging	Het
Fam3b	T	A	16: 97,481,853	Y74F	probably benign	Het
Gm5464	T	C	14: 66,869,106	L64P	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Kcnh7	T	A	2: 62,764,608	H706L	probably damaging	Het
Kdm2b	C	T	5: 122,880,176	R1067H	probably damaging	Het
Klhl28	A	T	12: 64,950,090	H492Q	probably damaging	Het
Loxl3	T	A	6: 83,050,624	C716S	probably damaging	Het
Ltbp2	A	G	12: 84,786,413	Y1474H	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Mmp24	G	T	2: 155,814,015	V458L	probably benign	Het
Mpl	C	A	4: 118,446,109	S502I		Het
Nfatc1	A	T	18: 80,667,042	V503D	probably damaging	Het
Nim1k	A	G	13: 119,714,271	I133T	possibly damaging	Het
Nr1d2	T	C	14: 18,215,031	Y327C	probably damaging	Het
Olfr1214	T	C	2: 88,988,065	T46A	probably benign	Het
Oma1	C	T	4: 103,328,916	R360*	probably null	Het
Oog2	T	A	4: 144,194,173	W59R	probably damaging	Het
Pcdh10	A	G	3: 45,379,539	E96G	probably damaging	Het
Pcna	T	A	2: 132,251,930	T98S	probably benign	Het
Pcnx3	C	T	19: 5,679,590	C899Y	possibly damaging	Het
Phf11d	T	C	14: 59,356,434	N97S	probably benign	Het
Plekhg4	G	A	8: 105,377,329	W431*	probably null	Het
Plk4	A	G	3: 40,813,466	T815A	probably benign	Het
Pnma2	C	T	14: 66,916,313	T62I	possibly damaging	Het
Ppp1r9a	C	T	6: 5,057,568	R548W	probably damaging	Het
Ptx3	A	G	3: 66,224,780	S241G	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rplp0	A	T	5: 115,560,764	K26N	probably damaging	Het
Sec62	A	C	3: 30,818,782	E338A	unknown	Het
Sema6a	T	C	18: 47,248,955	M842V	probably benign	Het
Serpina3j	T	C	12: 104,314,784	V72A	probably benign	Het
Siglecf	T	C	7: 43,351,944	F112S	probably damaging	Het
Slc29a4	A	G	5: 142,720,125	N455D	probably damaging	Het
Slc6a11	T	A	6: 114,131,437	F54Y	probably benign	Het
Spag6	G	A	2: 18,710,583	V80M	probably damaging	Het
Spic	T	C	10: 88,678,636	E34G	possibly damaging	Het
Tecpr2	A	G	12: 110,931,720	K469E	possibly damaging	Het
Them7	T	A	2: 105,297,845	L57Q	probably benign	Het
Tlr3	G	A	8: 45,396,941	A897V	probably damaging	Het
Tnp2	A	G	16: 10,788,508	C32R	possibly damaging	Het
Trpm6	A	T	19: 18,853,968	Q1399L	probably benign	Het
Ttn	C	A	2: 76,846,671	E11074*	probably null	Het
Ubash3b	G	A	9: 41,043,485	A243V	probably benign	Het
Vash1	G	A	12: 86,680,178	R64Q	possibly damaging	Het
Vmn1r167	T	A	7: 23,505,556	M12L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,581	H645L	probably benign	Het
Vmn2r75	A	T	7: 86,148,514	I697K	probably damaging	Het
Vmn2r87	A	G	10: 130,472,257	I704T	probably damaging	Het

Other mutations in Dnah3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Dnah3	APN	7	119938905	missense	possibly damaging	0.88
IGL01095:Dnah3	APN	7	119951597	missense	probably benign	0.02
IGL01329:Dnah3	APN	7	120022941	missense	probably damaging	1.00
IGL01380:Dnah3	APN	7	119926564	missense	probably damaging	1.00
IGL01410:Dnah3	APN	7	119967720	missense	possibly damaging	0.91
IGL01487:Dnah3	APN	7	119965530	nonsense	probably null
IGL01843:Dnah3	APN	7	119943575	missense	probably benign	0.12
IGL01929:Dnah3	APN	7	119951651	nonsense	probably null
IGL01994:Dnah3	APN	7	119951214	missense	possibly damaging	0.58
IGL02115:Dnah3	APN	7	120029054	missense	probably damaging	1.00
IGL02273:Dnah3	APN	7	119951271	missense	probably damaging	1.00
IGL02299:Dnah3	APN	7	119967579	missense	probably benign	0.39
IGL02421:Dnah3	APN	7	119950992	missense	possibly damaging	0.87
IGL02514:Dnah3	APN	7	119966247	missense	probably damaging	1.00
IGL02596:Dnah3	APN	7	119938914	missense	probably benign	0.19
IGL02716:Dnah3	APN	7	119937023	missense	probably damaging	0.97
IGL02738:Dnah3	APN	7	119965497	missense	probably benign
IGL03404:Dnah3	APN	7	119938977	missense	probably damaging	1.00
R0964_Dnah3_480	UTSW	7	119952739	splice site	probably benign
R1778_Dnah3_238	UTSW	7	120078402	missense	probably damaging	1.00
R4658_Dnah3_599	UTSW	7	119950651	missense	probably damaging	1.00
BB004:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
BB014:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
R0011:Dnah3	UTSW	7	120019701	missense	probably damaging	1.00
R0195:Dnah3	UTSW	7	120077775	critical splice donor site	probably null
R0241:Dnah3	UTSW	7	119922730	missense	probably damaging	1.00
R0241:Dnah3	UTSW	7	119922730	missense	probably damaging	1.00
R0312:Dnah3	UTSW	7	120045659	missense	probably damaging	1.00
R0316:Dnah3	UTSW	7	119965659	missense	possibly damaging	0.94
R0370:Dnah3	UTSW	7	120086720	missense	possibly damaging	0.91
R0426:Dnah3	UTSW	7	119943572	missense	probably benign	0.11
R0525:Dnah3	UTSW	7	119928754	missense	probably damaging	1.00
R0625:Dnah3	UTSW	7	120071887	missense	possibly damaging	0.68
R0627:Dnah3	UTSW	7	120020915	missense	probably damaging	1.00
R0632:Dnah3	UTSW	7	119967905	missense	probably benign	0.11
R0928:Dnah3	UTSW	7	120030051	missense	probably damaging	1.00
R0964:Dnah3	UTSW	7	119952739	splice site	probably benign
R0972:Dnah3	UTSW	7	120035340	splice site	probably null
R1066:Dnah3	UTSW	7	120061009	missense	probably damaging	1.00
R1082:Dnah3	UTSW	7	120078445	missense	probably damaging	1.00
R1127:Dnah3	UTSW	7	119923030	missense	probably damaging	1.00
R1132:Dnah3	UTSW	7	119939004	missense	possibly damaging	0.50
R1222:Dnah3	UTSW	7	120090676	missense	probably benign	0.28
R1420:Dnah3	UTSW	7	119951979	missense	probably damaging	0.99
R1456:Dnah3	UTSW	7	120047630	missense	probably damaging	1.00
R1472:Dnah3	UTSW	7	120070958	missense	probably benign	0.12
R1617:Dnah3	UTSW	7	120089946	missense	probably benign	0.01
R1624:Dnah3	UTSW	7	120019695	missense	probably damaging	0.99
R1654:Dnah3	UTSW	7	119926449	missense	probably damaging	1.00
R1673:Dnah3	UTSW	7	119971179	nonsense	probably null
R1677:Dnah3	UTSW	7	119928740	missense	probably damaging	1.00
R1687:Dnah3	UTSW	7	120045786	splice site	probably null
R1711:Dnah3	UTSW	7	120078571	missense	probably damaging	1.00
R1738:Dnah3	UTSW	7	120035359	missense	probably damaging	1.00
R1778:Dnah3	UTSW	7	120078402	missense	probably damaging	1.00
R1866:Dnah3	UTSW	7	119928856	splice site	probably null
R1883:Dnah3	UTSW	7	120077919	missense	probably benign	0.06
R1894:Dnah3	UTSW	7	120086334	missense	probably benign	0.05
R1929:Dnah3	UTSW	7	119975129	missense	probably benign	0.10
R1988:Dnah3	UTSW	7	119967570	missense	possibly damaging	0.92
R1988:Dnah3	UTSW	7	119967959	missense	probably damaging	0.99
R2010:Dnah3	UTSW	7	120095177	start codon destroyed	probably benign	0.00
R2022:Dnah3	UTSW	7	119951242	missense	probably damaging	1.00
R2026:Dnah3	UTSW	7	120039406	missense	probably damaging	1.00
R2063:Dnah3	UTSW	7	119951909	missense	probably damaging	0.96
R2131:Dnah3	UTSW	7	119967759	missense	possibly damaging	0.93
R2152:Dnah3	UTSW	7	119952013	missense	probably benign	0.02
R2199:Dnah3	UTSW	7	119951569	missense	possibly damaging	0.89
R2271:Dnah3	UTSW	7	119975129	missense	probably benign	0.10
R2350:Dnah3	UTSW	7	120045788	splice site	probably null
R2567:Dnah3	UTSW	7	119952697	missense	possibly damaging	0.83
R2848:Dnah3	UTSW	7	119967938	missense	probably benign	0.01
R2902:Dnah3	UTSW	7	119951499	missense	possibly damaging	0.61
R2926:Dnah3	UTSW	7	119951115	missense	probably damaging	1.00
R2944:Dnah3	UTSW	7	119951110	missense	probably damaging	1.00
R3022:Dnah3	UTSW	7	120078481	missense	possibly damaging	0.93
R3401:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3402:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3403:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3919:Dnah3	UTSW	7	119951080	missense	probably damaging	1.00
R3972:Dnah3	UTSW	7	120086720	missense	probably damaging	0.99
R4162:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4184:Dnah3	UTSW	7	120083293	missense	probably damaging	1.00
R4198:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4199:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4200:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4239:Dnah3	UTSW	7	120029025	nonsense	probably null
R4478:Dnah3	UTSW	7	120071863	missense	probably benign	0.00
R4579:Dnah3	UTSW	7	120009331	missense	probably damaging	1.00
R4600:Dnah3	UTSW	7	120089946	missense	probably benign
R4649:Dnah3	UTSW	7	120047698	missense	probably damaging	1.00
R4658:Dnah3	UTSW	7	119950651	missense	probably damaging	1.00
R4728:Dnah3	UTSW	7	120059366	missense	probably damaging	0.99
R4739:Dnah3	UTSW	7	120077946	missense	possibly damaging	0.54
R4758:Dnah3	UTSW	7	120079406	missense	probably benign	0.00
R4785:Dnah3	UTSW	7	119967824	missense	probably benign	0.29
R4789:Dnah3	UTSW	7	120011072	missense	probably damaging	1.00
R4930:Dnah3	UTSW	7	119951681	nonsense	probably null
R4935:Dnah3	UTSW	7	120016477	nonsense	probably null
R4946:Dnah3	UTSW	7	119931560	missense	probably damaging	1.00
R4981:Dnah3	UTSW	7	119956201	missense	probably benign	0.03
R4984:Dnah3	UTSW	7	119928779	missense	probably benign	0.04
R5025:Dnah3	UTSW	7	120071905	missense	probably benign	0.02
R5046:Dnah3	UTSW	7	119951580	missense	probably damaging	1.00
R5056:Dnah3	UTSW	7	120020946	missense	probably damaging	1.00
R5068:Dnah3	UTSW	7	120032790	missense	probably benign
R5069:Dnah3	UTSW	7	120032790	missense	probably benign
R5154:Dnah3	UTSW	7	119952419	missense	probably damaging	1.00
R5208:Dnah3	UTSW	7	120032638	missense	probably damaging	1.00
R5323:Dnah3	UTSW	7	120021011	missense	probably damaging	1.00
R5330:Dnah3	UTSW	7	119943648	missense	probably benign	0.00
R5385:Dnah3	UTSW	7	119924903	missense	probably damaging	1.00
R5391:Dnah3	UTSW	7	120090076	missense	probably benign	0.02
R5564:Dnah3	UTSW	7	119971466	critical splice donor site	probably null
R5594:Dnah3	UTSW	7	119971621	missense	possibly damaging	0.89
R5610:Dnah3	UTSW	7	119939065	splice site	probably null
R5673:Dnah3	UTSW	7	119951589	missense	possibly damaging	0.91
R5678:Dnah3	UTSW	7	120077851	missense	probably benign	0.00
R5737:Dnah3	UTSW	7	120059198	missense	probably benign	0.03
R5766:Dnah3	UTSW	7	119978222	missense	probably damaging	1.00
R5769:Dnah3	UTSW	7	120089952	nonsense	probably null
R5789:Dnah3	UTSW	7	119943599	missense	possibly damaging	0.70
R5791:Dnah3	UTSW	7	119931473	missense	probably benign	0.00
R5841:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5843:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5844:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5846:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5851:Dnah3	UTSW	7	120039362	missense	possibly damaging	0.51
R5853:Dnah3	UTSW	7	119938833	missense	probably damaging	1.00
R5857:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5865:Dnah3	UTSW	7	119975108	missense	probably benign	0.00
R5885:Dnah3	UTSW	7	120069704	missense	probably benign	0.10
R5898:Dnah3	UTSW	7	120078501	missense	probably benign	0.37
R5917:Dnah3	UTSW	7	120016526	missense	probably damaging	1.00
R5964:Dnah3	UTSW	7	119922880	missense	probably benign	0.00
R5990:Dnah3	UTSW	7	120073541	missense	probably benign
R6004:Dnah3	UTSW	7	120086297	missense	probably benign	0.10
R6033:Dnah3	UTSW	7	120071647	missense	probably benign	0.00
R6033:Dnah3	UTSW	7	120071647	missense	probably benign	0.00
R6045:Dnah3	UTSW	7	119967522	missense	probably damaging	0.99
R6056:Dnah3	UTSW	7	120030031	missense	probably damaging	1.00
R6133:Dnah3	UTSW	7	120086246	missense	probably benign	0.10
R6229:Dnah3	UTSW	7	119965488	missense	probably benign	0.11
R6237:Dnah3	UTSW	7	120009384	missense	probably damaging	1.00
R6333:Dnah3	UTSW	7	120054633	missense	probably damaging	1.00
R6408:Dnah3	UTSW	7	119922968	splice site	probably null
R6447:Dnah3	UTSW	7	119923054	missense	probably benign	0.12
R6606:Dnah3	UTSW	7	120060956	missense	probably benign	0.02
R6666:Dnah3	UTSW	7	120070949	missense	probably benign	0.16
R6733:Dnah3	UTSW	7	119922974	missense	probably benign	0.22
R6815:Dnah3	UTSW	7	119971727	missense	probably benign
R6882:Dnah3	UTSW	7	119971184	missense	possibly damaging	0.95
R6934:Dnah3	UTSW	7	120054601	critical splice donor site	probably null
R6966:Dnah3	UTSW	7	120032754	missense	probably damaging	1.00
R7025:Dnah3	UTSW	7	120030010	missense	possibly damaging	0.90
R7207:Dnah3	UTSW	7	119971089	missense	probably damaging	1.00
R7214:Dnah3	UTSW	7	119922742	missense	probably damaging	1.00
R7222:Dnah3	UTSW	7	120071523	missense	probably benign	0.00
R7235:Dnah3	UTSW	7	120032670	missense	probably damaging	1.00
R7241:Dnah3	UTSW	7	119943633	missense	probably benign	0.03
R7313:Dnah3	UTSW	7	119981344	missense	probably benign	0.39
R7342:Dnah3	UTSW	7	120029985	missense	probably damaging	1.00
R7368:Dnah3	UTSW	7	120029016	missense	probably benign
R7375:Dnah3	UTSW	7	119951677	missense	probably damaging	1.00
R7395:Dnah3	UTSW	7	119966251	missense
R7395:Dnah3	UTSW	7	120060960	missense	probably benign	0.00
R7431:Dnah3	UTSW	7	120051744	missense	probably damaging	1.00
R7499:Dnah3	UTSW	7	120060912	missense	probably damaging	0.99
R7515:Dnah3	UTSW	7	120073592	missense	probably benign	0.21
R7564:Dnah3	UTSW	7	119971594	missense	probably benign
R7618:Dnah3	UTSW	7	119978378	missense	probably damaging	0.97
R7697:Dnah3	UTSW	7	119967434	missense
R7728:Dnah3	UTSW	7	119938828	missense	probably damaging	1.00
R7757:Dnah3	UTSW	7	120071570	missense	probably benign
R7757:Dnah3	UTSW	7	119971215	splice site	probably null
R7774:Dnah3	UTSW	7	119951752	nonsense	probably null
R7804:Dnah3	UTSW	7	119952618	missense	probably damaging	1.00
R7804:Dnah3	UTSW	7	120011012	missense	probably damaging	1.00
R7857:Dnah3	UTSW	7	119951704	missense	probably damaging	1.00
R7871:Dnah3	UTSW	7	119967552	missense
R7903:Dnah3	UTSW	7	120042128	missense	probably damaging	1.00
R7927:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
R7989:Dnah3	UTSW	7	120077789	missense	probably benign
R8142:Dnah3	UTSW	7	120060966	missense	probably benign	0.00
R8164:Dnah3	UTSW	7	119967614	missense	probably damaging	1.00
R8237:Dnah3	UTSW	7	119926413	missense	probably benign	0.01
R8313:Dnah3	UTSW	7	119951152	missense	probably benign	0.38
R8338:Dnah3	UTSW	7	120071881	missense	probably benign	0.01
R8355:Dnah3	UTSW	7	119952208	missense	probably damaging	1.00
R8408:Dnah3	UTSW	7	119952505	missense	probably damaging	1.00
R8455:Dnah3	UTSW	7	119952208	missense	probably damaging	1.00
R8483:Dnah3	UTSW	7	119937030	missense	probably benign	0.00
R8531:Dnah3	UTSW	7	119951368	missense	probably damaging	1.00
R8885:Dnah3	UTSW	7	119962152	missense
R8912:Dnah3	UTSW	7	120090646	missense	probably benign	0.06
R8966:Dnah3	UTSW	7	119950658	nonsense	probably null
R8982:Dnah3	UTSW	7	119937071	missense	probably damaging	1.00
R9043:Dnah3	UTSW	7	119952049	missense	probably benign
R9053:Dnah3	UTSW	7	120019764	missense	possibly damaging	0.67
R9059:Dnah3	UTSW	7	120085145	missense	probably benign	0.01
R9182:Dnah3	UTSW	7	120085128	missense	probably damaging	0.98
R9365:Dnah3	UTSW	7	119967636	missense
R9383:Dnah3	UTSW	7	120047596	missense	probably benign	0.23
R9430:Dnah3	UTSW	7	120028982	missense	probably damaging	1.00
R9449:Dnah3	UTSW	7	119952250	missense	probably benign	0.12
R9462:Dnah3	UTSW	7	119952300	missense	probably benign	0.05
R9505:Dnah3	UTSW	7	120045689	missense	probably damaging	1.00
R9559:Dnah3	UTSW	7	120051728	missense	probably benign	0.07
R9562:Dnah3	UTSW	7	120010891	missense	probably benign	0.05
R9565:Dnah3	UTSW	7	120010891	missense	probably benign	0.05
R9609:Dnah3	UTSW	7	120071013	missense	probably damaging	0.98
R9622:Dnah3	UTSW	7	119962133	missense
R9633:Dnah3	UTSW	7	119950993	missense	probably benign
R9654:Dnah3	UTSW	7	120042173	nonsense	probably null
R9665:Dnah3	UTSW	7	120045758	missense	probably benign	0.01
R9681:Dnah3	UTSW	7	120078388	missense	probably benign	0.04
R9717:Dnah3	UTSW	7	119975076	missense	probably damaging	1.00
Z1088:Dnah3	UTSW	7	120010873	missense	probably null	1.00
Z1088:Dnah3	UTSW	7	120086297	missense	probably benign	0.00
Z1176:Dnah3	UTSW	7	119967803	missense
Z1177:Dnah3	UTSW	7	119967901	missense	probably damaging	0.99
Z1177:Dnah3	UTSW	7	120007862	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAATAAGTGATAGGCTTGGTAGCTACC -3'
(R):5'- CCCCAATCTTTATAAGGACCGG -3'

Sequencing Primer
(F):5'- AGCTACCTTTTTATTGTCATCCAGG -3'
(R):5'- CCAATCTTTATAAGGACCGGGTGTC -3'

Posted On

2020-10-20