Incidental Mutation 'R8411:Dnah3'
ID 652680
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Name dynein, axonemal, heavy chain 3
Synonyms Dnahc3
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 119521894-119694503 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 119610253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 1728 (D1728Y)
Ref Sequence ENSEMBL: ENSMUSP00000042857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046993
AA Change: D1728Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: D1728Y

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209154
AA Change: D1717Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119,538,128 (GRCm39) missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119,550,820 (GRCm39) missense probably benign 0.02
IGL01329:Dnah3 APN 7 119,622,164 (GRCm39) missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119,525,787 (GRCm39) missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119,566,943 (GRCm39) missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119,564,753 (GRCm39) nonsense probably null
IGL01843:Dnah3 APN 7 119,542,798 (GRCm39) missense probably benign 0.12
IGL01929:Dnah3 APN 7 119,550,874 (GRCm39) nonsense probably null
IGL01994:Dnah3 APN 7 119,550,437 (GRCm39) missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 119,628,277 (GRCm39) missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119,550,494 (GRCm39) missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119,566,802 (GRCm39) missense probably benign 0.39
IGL02421:Dnah3 APN 7 119,550,215 (GRCm39) missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119,565,470 (GRCm39) missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119,538,137 (GRCm39) missense probably benign 0.19
IGL02716:Dnah3 APN 7 119,536,246 (GRCm39) missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119,564,720 (GRCm39) missense probably benign
IGL03404:Dnah3 APN 7 119,538,200 (GRCm39) missense probably damaging 1.00
R0964_Dnah3_480 UTSW 7 119,551,962 (GRCm39) splice site probably benign
R1778_Dnah3_238 UTSW 7 119,677,625 (GRCm39) missense probably damaging 1.00
R4658_Dnah3_599 UTSW 7 119,549,874 (GRCm39) missense probably damaging 1.00
BB004:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
BB014:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
R0011:Dnah3 UTSW 7 119,618,924 (GRCm39) missense probably damaging 1.00
R0195:Dnah3 UTSW 7 119,676,998 (GRCm39) critical splice donor site probably null
R0241:Dnah3 UTSW 7 119,521,953 (GRCm39) missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119,521,953 (GRCm39) missense probably damaging 1.00
R0312:Dnah3 UTSW 7 119,644,882 (GRCm39) missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119,564,882 (GRCm39) missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 119,685,943 (GRCm39) missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119,542,795 (GRCm39) missense probably benign 0.11
R0525:Dnah3 UTSW 7 119,527,977 (GRCm39) missense probably damaging 1.00
R0625:Dnah3 UTSW 7 119,671,110 (GRCm39) missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 119,620,138 (GRCm39) missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119,567,128 (GRCm39) missense probably benign 0.11
R0928:Dnah3 UTSW 7 119,629,274 (GRCm39) missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119,551,962 (GRCm39) splice site probably benign
R0972:Dnah3 UTSW 7 119,634,563 (GRCm39) splice site probably null
R1066:Dnah3 UTSW 7 119,660,232 (GRCm39) missense probably damaging 1.00
R1082:Dnah3 UTSW 7 119,677,668 (GRCm39) missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119,522,253 (GRCm39) missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119,538,227 (GRCm39) missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 119,689,899 (GRCm39) missense probably benign 0.28
R1420:Dnah3 UTSW 7 119,551,202 (GRCm39) missense probably damaging 0.99
R1456:Dnah3 UTSW 7 119,646,853 (GRCm39) missense probably damaging 1.00
R1472:Dnah3 UTSW 7 119,670,181 (GRCm39) missense probably benign 0.12
R1617:Dnah3 UTSW 7 119,689,169 (GRCm39) missense probably benign 0.01
R1624:Dnah3 UTSW 7 119,618,918 (GRCm39) missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119,525,672 (GRCm39) missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119,570,402 (GRCm39) nonsense probably null
R1677:Dnah3 UTSW 7 119,527,963 (GRCm39) missense probably damaging 1.00
R1687:Dnah3 UTSW 7 119,645,009 (GRCm39) splice site probably null
R1711:Dnah3 UTSW 7 119,677,794 (GRCm39) missense probably damaging 1.00
R1738:Dnah3 UTSW 7 119,634,582 (GRCm39) missense probably damaging 1.00
R1778:Dnah3 UTSW 7 119,677,625 (GRCm39) missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119,528,079 (GRCm39) splice site probably null
R1883:Dnah3 UTSW 7 119,677,142 (GRCm39) missense probably benign 0.06
R1894:Dnah3 UTSW 7 119,685,557 (GRCm39) missense probably benign 0.05
R1929:Dnah3 UTSW 7 119,574,352 (GRCm39) missense probably benign 0.10
R1988:Dnah3 UTSW 7 119,567,182 (GRCm39) missense probably damaging 0.99
R1988:Dnah3 UTSW 7 119,566,793 (GRCm39) missense possibly damaging 0.92
R2010:Dnah3 UTSW 7 119,694,400 (GRCm39) start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119,550,465 (GRCm39) missense probably damaging 1.00
R2026:Dnah3 UTSW 7 119,638,629 (GRCm39) missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119,551,132 (GRCm39) missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119,566,982 (GRCm39) missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119,551,236 (GRCm39) missense probably benign 0.02
R2199:Dnah3 UTSW 7 119,550,792 (GRCm39) missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119,574,352 (GRCm39) missense probably benign 0.10
R2350:Dnah3 UTSW 7 119,645,011 (GRCm39) splice site probably null
R2567:Dnah3 UTSW 7 119,551,920 (GRCm39) missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119,567,161 (GRCm39) missense probably benign 0.01
R2902:Dnah3 UTSW 7 119,550,722 (GRCm39) missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119,550,338 (GRCm39) missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119,550,333 (GRCm39) missense probably damaging 1.00
R3022:Dnah3 UTSW 7 119,677,704 (GRCm39) missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3402:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3403:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3919:Dnah3 UTSW 7 119,550,303 (GRCm39) missense probably damaging 1.00
R3972:Dnah3 UTSW 7 119,685,943 (GRCm39) missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4184:Dnah3 UTSW 7 119,682,516 (GRCm39) missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4239:Dnah3 UTSW 7 119,628,248 (GRCm39) nonsense probably null
R4478:Dnah3 UTSW 7 119,671,086 (GRCm39) missense probably benign 0.00
R4579:Dnah3 UTSW 7 119,608,554 (GRCm39) missense probably damaging 1.00
R4600:Dnah3 UTSW 7 119,689,169 (GRCm39) missense probably benign
R4649:Dnah3 UTSW 7 119,646,921 (GRCm39) missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119,549,874 (GRCm39) missense probably damaging 1.00
R4728:Dnah3 UTSW 7 119,658,589 (GRCm39) missense probably damaging 0.99
R4739:Dnah3 UTSW 7 119,677,169 (GRCm39) missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 119,678,629 (GRCm39) missense probably benign 0.00
R4785:Dnah3 UTSW 7 119,567,047 (GRCm39) missense probably benign 0.29
R4789:Dnah3 UTSW 7 119,610,295 (GRCm39) missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119,550,904 (GRCm39) nonsense probably null
R4935:Dnah3 UTSW 7 119,615,700 (GRCm39) nonsense probably null
R4946:Dnah3 UTSW 7 119,530,783 (GRCm39) missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119,555,424 (GRCm39) missense probably benign 0.03
R4984:Dnah3 UTSW 7 119,528,002 (GRCm39) missense probably benign 0.04
R5025:Dnah3 UTSW 7 119,671,128 (GRCm39) missense probably benign 0.02
R5046:Dnah3 UTSW 7 119,550,803 (GRCm39) missense probably damaging 1.00
R5056:Dnah3 UTSW 7 119,620,169 (GRCm39) missense probably damaging 1.00
R5068:Dnah3 UTSW 7 119,632,013 (GRCm39) missense probably benign
R5069:Dnah3 UTSW 7 119,632,013 (GRCm39) missense probably benign
R5154:Dnah3 UTSW 7 119,551,642 (GRCm39) missense probably damaging 1.00
R5208:Dnah3 UTSW 7 119,631,861 (GRCm39) missense probably damaging 1.00
R5323:Dnah3 UTSW 7 119,620,234 (GRCm39) missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119,542,871 (GRCm39) missense probably benign 0.00
R5385:Dnah3 UTSW 7 119,524,126 (GRCm39) missense probably damaging 1.00
R5391:Dnah3 UTSW 7 119,689,299 (GRCm39) missense probably benign 0.02
R5564:Dnah3 UTSW 7 119,570,689 (GRCm39) critical splice donor site probably null
R5594:Dnah3 UTSW 7 119,570,844 (GRCm39) missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119,538,288 (GRCm39) splice site probably null
R5673:Dnah3 UTSW 7 119,550,812 (GRCm39) missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 119,677,074 (GRCm39) missense probably benign 0.00
R5737:Dnah3 UTSW 7 119,658,421 (GRCm39) missense probably benign 0.03
R5766:Dnah3 UTSW 7 119,577,445 (GRCm39) missense probably damaging 1.00
R5769:Dnah3 UTSW 7 119,689,175 (GRCm39) nonsense probably null
R5789:Dnah3 UTSW 7 119,542,822 (GRCm39) missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119,530,696 (GRCm39) missense probably benign 0.00
R5841:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5851:Dnah3 UTSW 7 119,638,585 (GRCm39) missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119,538,056 (GRCm39) missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119,574,331 (GRCm39) missense probably benign 0.00
R5885:Dnah3 UTSW 7 119,668,927 (GRCm39) missense probably benign 0.10
R5898:Dnah3 UTSW 7 119,677,724 (GRCm39) missense probably benign 0.37
R5917:Dnah3 UTSW 7 119,615,749 (GRCm39) missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119,522,103 (GRCm39) missense probably benign 0.00
R5990:Dnah3 UTSW 7 119,672,764 (GRCm39) missense probably benign
R6004:Dnah3 UTSW 7 119,685,520 (GRCm39) missense probably benign 0.10
R6033:Dnah3 UTSW 7 119,670,870 (GRCm39) missense probably benign 0.00
R6033:Dnah3 UTSW 7 119,670,870 (GRCm39) missense probably benign 0.00
R6045:Dnah3 UTSW 7 119,566,745 (GRCm39) missense probably damaging 0.99
R6056:Dnah3 UTSW 7 119,629,254 (GRCm39) missense probably damaging 1.00
R6133:Dnah3 UTSW 7 119,685,469 (GRCm39) missense probably benign 0.10
R6229:Dnah3 UTSW 7 119,564,711 (GRCm39) missense probably benign 0.11
R6237:Dnah3 UTSW 7 119,608,607 (GRCm39) missense probably damaging 1.00
R6333:Dnah3 UTSW 7 119,653,856 (GRCm39) missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119,522,191 (GRCm39) splice site probably null
R6447:Dnah3 UTSW 7 119,522,277 (GRCm39) missense probably benign 0.12
R6606:Dnah3 UTSW 7 119,660,179 (GRCm39) missense probably benign 0.02
R6666:Dnah3 UTSW 7 119,670,172 (GRCm39) missense probably benign 0.16
R6733:Dnah3 UTSW 7 119,522,197 (GRCm39) missense probably benign 0.22
R6815:Dnah3 UTSW 7 119,570,950 (GRCm39) missense probably benign
R6882:Dnah3 UTSW 7 119,570,407 (GRCm39) missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 119,653,824 (GRCm39) critical splice donor site probably null
R6966:Dnah3 UTSW 7 119,631,977 (GRCm39) missense probably damaging 1.00
R7025:Dnah3 UTSW 7 119,629,233 (GRCm39) missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119,570,312 (GRCm39) missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119,521,965 (GRCm39) missense probably damaging 1.00
R7222:Dnah3 UTSW 7 119,670,746 (GRCm39) missense probably benign 0.00
R7235:Dnah3 UTSW 7 119,631,893 (GRCm39) missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119,542,856 (GRCm39) missense probably benign 0.03
R7313:Dnah3 UTSW 7 119,580,567 (GRCm39) missense probably benign 0.39
R7342:Dnah3 UTSW 7 119,629,208 (GRCm39) missense probably damaging 1.00
R7368:Dnah3 UTSW 7 119,628,239 (GRCm39) missense probably benign
R7375:Dnah3 UTSW 7 119,550,900 (GRCm39) missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119,660,183 (GRCm39) missense probably benign 0.00
R7395:Dnah3 UTSW 7 119,565,474 (GRCm39) missense
R7431:Dnah3 UTSW 7 119,650,967 (GRCm39) missense probably damaging 1.00
R7499:Dnah3 UTSW 7 119,660,135 (GRCm39) missense probably damaging 0.99
R7515:Dnah3 UTSW 7 119,672,815 (GRCm39) missense probably benign 0.21
R7564:Dnah3 UTSW 7 119,570,817 (GRCm39) missense probably benign
R7618:Dnah3 UTSW 7 119,577,601 (GRCm39) missense probably damaging 0.97
R7697:Dnah3 UTSW 7 119,566,657 (GRCm39) missense
R7728:Dnah3 UTSW 7 119,538,051 (GRCm39) missense probably damaging 1.00
R7757:Dnah3 UTSW 7 119,570,438 (GRCm39) splice site probably null
R7757:Dnah3 UTSW 7 119,670,793 (GRCm39) missense probably benign
R7774:Dnah3 UTSW 7 119,550,975 (GRCm39) nonsense probably null
R7804:Dnah3 UTSW 7 119,610,235 (GRCm39) missense probably damaging 1.00
R7804:Dnah3 UTSW 7 119,551,841 (GRCm39) missense probably damaging 1.00
R7857:Dnah3 UTSW 7 119,550,927 (GRCm39) missense probably damaging 1.00
R7871:Dnah3 UTSW 7 119,566,775 (GRCm39) missense
R7903:Dnah3 UTSW 7 119,641,351 (GRCm39) missense probably damaging 1.00
R7927:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
R7989:Dnah3 UTSW 7 119,677,012 (GRCm39) missense probably benign
R8142:Dnah3 UTSW 7 119,660,189 (GRCm39) missense probably benign 0.00
R8164:Dnah3 UTSW 7 119,566,837 (GRCm39) missense probably damaging 1.00
R8237:Dnah3 UTSW 7 119,525,636 (GRCm39) missense probably benign 0.01
R8313:Dnah3 UTSW 7 119,550,375 (GRCm39) missense probably benign 0.38
R8338:Dnah3 UTSW 7 119,671,104 (GRCm39) missense probably benign 0.01
R8355:Dnah3 UTSW 7 119,551,431 (GRCm39) missense probably damaging 1.00
R8408:Dnah3 UTSW 7 119,551,728 (GRCm39) missense probably damaging 1.00
R8455:Dnah3 UTSW 7 119,551,431 (GRCm39) missense probably damaging 1.00
R8483:Dnah3 UTSW 7 119,536,253 (GRCm39) missense probably benign 0.00
R8531:Dnah3 UTSW 7 119,550,591 (GRCm39) missense probably damaging 1.00
R8885:Dnah3 UTSW 7 119,561,375 (GRCm39) missense
R8912:Dnah3 UTSW 7 119,689,869 (GRCm39) missense probably benign 0.06
R8966:Dnah3 UTSW 7 119,549,881 (GRCm39) nonsense probably null
R8982:Dnah3 UTSW 7 119,536,294 (GRCm39) missense probably damaging 1.00
R9043:Dnah3 UTSW 7 119,551,272 (GRCm39) missense probably benign
R9053:Dnah3 UTSW 7 119,618,987 (GRCm39) missense possibly damaging 0.67
R9059:Dnah3 UTSW 7 119,684,368 (GRCm39) missense probably benign 0.01
R9182:Dnah3 UTSW 7 119,684,351 (GRCm39) missense probably damaging 0.98
R9365:Dnah3 UTSW 7 119,566,859 (GRCm39) missense
R9383:Dnah3 UTSW 7 119,646,819 (GRCm39) missense probably benign 0.23
R9430:Dnah3 UTSW 7 119,628,205 (GRCm39) missense probably damaging 1.00
R9449:Dnah3 UTSW 7 119,551,473 (GRCm39) missense probably benign 0.12
R9462:Dnah3 UTSW 7 119,551,523 (GRCm39) missense probably benign 0.05
R9505:Dnah3 UTSW 7 119,644,912 (GRCm39) missense probably damaging 1.00
R9559:Dnah3 UTSW 7 119,650,951 (GRCm39) missense probably benign 0.07
R9562:Dnah3 UTSW 7 119,610,114 (GRCm39) missense probably benign 0.05
R9565:Dnah3 UTSW 7 119,610,114 (GRCm39) missense probably benign 0.05
R9609:Dnah3 UTSW 7 119,670,236 (GRCm39) missense probably damaging 0.98
R9622:Dnah3 UTSW 7 119,561,356 (GRCm39) missense
R9633:Dnah3 UTSW 7 119,550,216 (GRCm39) missense probably benign
R9654:Dnah3 UTSW 7 119,641,396 (GRCm39) nonsense probably null
R9665:Dnah3 UTSW 7 119,644,981 (GRCm39) missense probably benign 0.01
R9681:Dnah3 UTSW 7 119,677,611 (GRCm39) missense probably benign 0.04
R9717:Dnah3 UTSW 7 119,574,299 (GRCm39) missense probably damaging 1.00
Z1088:Dnah3 UTSW 7 119,610,096 (GRCm39) missense probably null 1.00
Z1088:Dnah3 UTSW 7 119,685,520 (GRCm39) missense probably benign 0.00
Z1176:Dnah3 UTSW 7 119,567,026 (GRCm39) missense
Z1177:Dnah3 UTSW 7 119,607,085 (GRCm39) missense probably benign
Z1177:Dnah3 UTSW 7 119,567,124 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATAAGTGATAGGCTTGGTAGCTACC -3'
(R):5'- CCCCAATCTTTATAAGGACCGG -3'

Sequencing Primer
(F):5'- AGCTACCTTTTTATTGTCATCCAGG -3'
(R):5'- CCAATCTTTATAAGGACCGGGTGTC -3'
Posted On 2020-10-20