Incidental Mutation 'R8411:Tlr3'
ID 652682
Institutional Source Beutler Lab
Gene Symbol Tlr3
Ensembl Gene ENSMUSG00000031639
Gene Name toll-like receptor 3
Synonyms
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 45848702-45864112 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 45849978 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 897 (A897V)
Ref Sequence ENSEMBL: ENSMUSP00000034056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034056] [ENSMUST00000167106] [ENSMUST00000209772] [ENSMUST00000210013]
AlphaFold Q99MB1
PDB Structure Crystal structure of mouse TLR3 ectodomain [X-RAY DIFFRACTION]
Mouse Toll-like receptor 3 ectodomain complexed with double-stranded RNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034056
AA Change: A897V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034056
Gene: ENSMUSG00000031639
AA Change: A897V

DomainStartEndE-ValueType
LRRNT 28 56 1.14e1 SMART
LRR 50 74 1.33e1 SMART
LRR_TYP 99 122 4.72e-2 SMART
LRR 123 146 2.47e2 SMART
LRR 171 194 3.36e1 SMART
LRR 198 220 7.57e0 SMART
low complexity region 224 238 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
LRR 274 297 1.06e1 SMART
LRR_TYP 298 321 1.28e-3 SMART
LRR 355 378 6.23e1 SMART
LRR 379 404 3.18e2 SMART
LRR 405 430 8.98e1 SMART
LRR 431 455 6.78e1 SMART
LRR_TYP 506 529 1.79e-2 SMART
LRR 530 553 2.63e0 SMART
LRR_TYP 562 585 1.56e-2 SMART
LRR 586 609 1.37e1 SMART
LRR 611 633 8.48e0 SMART
LRRCT 646 698 1.07e-10 SMART
transmembrane domain 705 724 N/A INTRINSIC
TIR 756 901 2.43e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167106
AA Change: A897V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126556
Gene: ENSMUSG00000031639
AA Change: A897V

DomainStartEndE-ValueType
LRRNT 28 56 1.14e1 SMART
LRR 50 74 1.33e1 SMART
LRR_TYP 99 122 4.72e-2 SMART
LRR 123 146 2.47e2 SMART
LRR 171 194 3.36e1 SMART
LRR 198 220 7.57e0 SMART
low complexity region 224 238 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
LRR 274 297 1.06e1 SMART
LRR_TYP 298 321 1.28e-3 SMART
LRR 355 378 6.23e1 SMART
LRR 379 404 3.18e2 SMART
LRR 405 430 8.98e1 SMART
LRR 431 455 6.78e1 SMART
LRR_TYP 506 529 1.79e-2 SMART
LRR 530 553 2.63e0 SMART
LRR_TYP 562 585 1.56e-2 SMART
LRR 586 609 1.37e1 SMART
LRR 611 633 8.48e0 SMART
LRRCT 646 698 1.07e-10 SMART
transmembrane domain 705 724 N/A INTRINSIC
TIR 756 901 2.43e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209772
AA Change: A897V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210013
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses. Use of alternative polyadenylation sites to generate different length transcripts has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show alterations in innate immunity against different viruses, viral pathogenesis, anxiety, hippocampal synaptic plasticity, memory retention and neurogenesis. Homozygotes for another null allele show altered ds-RNA responses in dendritic and aorta smooth muscle cells. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Tlr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tlr3 APN 8 45,853,727 (GRCm39) missense probably damaging 0.99
IGL01820:Tlr3 APN 8 45,851,376 (GRCm39) missense probably benign
IGL02504:Tlr3 APN 8 45,850,944 (GRCm39) missense probably damaging 1.00
IGL02523:Tlr3 APN 8 45,851,428 (GRCm39) splice site probably null
IGL03166:Tlr3 APN 8 45,855,965 (GRCm39) missense probably benign 0.05
IGL03287:Tlr3 APN 8 45,855,817 (GRCm39) missense probably benign
Rakshasa UTSW 8 45,850,734 (GRCm39) missense probably benign 0.08
Ultraman UTSW 8 45,856,018 (GRCm39) missense probably damaging 1.00
E0354:Tlr3 UTSW 8 45,853,857 (GRCm39) missense probably damaging 1.00
R0960:Tlr3 UTSW 8 45,850,452 (GRCm39) missense probably damaging 1.00
R1175:Tlr3 UTSW 8 45,850,171 (GRCm39) missense probably damaging 1.00
R1332:Tlr3 UTSW 8 45,851,774 (GRCm39) missense probably damaging 0.99
R1477:Tlr3 UTSW 8 45,851,202 (GRCm39) missense probably damaging 1.00
R1667:Tlr3 UTSW 8 45,853,874 (GRCm39) missense probably benign 0.00
R1755:Tlr3 UTSW 8 45,851,010 (GRCm39) missense probably benign
R1996:Tlr3 UTSW 8 45,850,734 (GRCm39) missense probably benign 0.08
R2012:Tlr3 UTSW 8 45,855,823 (GRCm39) missense possibly damaging 0.91
R2288:Tlr3 UTSW 8 45,850,705 (GRCm39) missense probably damaging 0.98
R2895:Tlr3 UTSW 8 45,850,629 (GRCm39) missense possibly damaging 0.89
R3837:Tlr3 UTSW 8 45,849,976 (GRCm39) missense probably damaging 1.00
R4905:Tlr3 UTSW 8 45,852,260 (GRCm39) critical splice acceptor site probably null
R4934:Tlr3 UTSW 8 45,850,072 (GRCm39) missense probably benign 0.10
R5025:Tlr3 UTSW 8 45,856,075 (GRCm39) missense probably benign 0.00
R5086:Tlr3 UTSW 8 45,855,862 (GRCm39) missense probably damaging 0.96
R5129:Tlr3 UTSW 8 45,856,018 (GRCm39) missense probably damaging 1.00
R5320:Tlr3 UTSW 8 45,852,137 (GRCm39) missense possibly damaging 0.95
R5411:Tlr3 UTSW 8 45,849,992 (GRCm39) missense probably benign 0.01
R5497:Tlr3 UTSW 8 45,851,851 (GRCm39) missense possibly damaging 0.60
R5498:Tlr3 UTSW 8 45,851,851 (GRCm39) missense possibly damaging 0.60
R5499:Tlr3 UTSW 8 45,851,851 (GRCm39) missense possibly damaging 0.60
R5501:Tlr3 UTSW 8 45,851,851 (GRCm39) missense possibly damaging 0.60
R5731:Tlr3 UTSW 8 45,851,157 (GRCm39) missense probably benign 0.00
R5761:Tlr3 UTSW 8 45,855,808 (GRCm39) missense probably benign 0.00
R5992:Tlr3 UTSW 8 45,850,851 (GRCm39) missense probably benign
R6031:Tlr3 UTSW 8 45,851,565 (GRCm39) missense probably damaging 1.00
R6031:Tlr3 UTSW 8 45,851,565 (GRCm39) missense probably damaging 1.00
R6104:Tlr3 UTSW 8 45,856,130 (GRCm39) missense probably benign 0.00
R6289:Tlr3 UTSW 8 45,849,966 (GRCm39) missense probably benign 0.04
R6372:Tlr3 UTSW 8 45,850,048 (GRCm39) missense probably damaging 1.00
R6470:Tlr3 UTSW 8 45,850,422 (GRCm39) missense probably damaging 1.00
R6486:Tlr3 UTSW 8 45,851,650 (GRCm39) splice site probably null
R6504:Tlr3 UTSW 8 45,850,486 (GRCm39) missense possibly damaging 0.79
R6721:Tlr3 UTSW 8 45,851,917 (GRCm39) missense probably benign 0.00
R7089:Tlr3 UTSW 8 45,850,810 (GRCm39) missense probably benign 0.02
R7169:Tlr3 UTSW 8 45,850,056 (GRCm39) missense probably damaging 1.00
R7679:Tlr3 UTSW 8 45,852,088 (GRCm39) missense probably benign
R7771:Tlr3 UTSW 8 45,856,076 (GRCm39) missense probably benign
R7863:Tlr3 UTSW 8 45,850,774 (GRCm39) missense probably benign 0.00
R7896:Tlr3 UTSW 8 45,850,090 (GRCm39) nonsense probably null
R8009:Tlr3 UTSW 8 45,853,819 (GRCm39) missense not run
R8219:Tlr3 UTSW 8 45,851,016 (GRCm39) missense possibly damaging 0.95
R8397:Tlr3 UTSW 8 45,851,896 (GRCm39) missense possibly damaging 0.94
R8539:Tlr3 UTSW 8 45,851,553 (GRCm39) missense probably damaging 1.00
R8786:Tlr3 UTSW 8 45,851,286 (GRCm39) missense possibly damaging 0.94
R8916:Tlr3 UTSW 8 45,856,076 (GRCm39) missense probably benign
R9282:Tlr3 UTSW 8 45,851,643 (GRCm39) missense probably benign 0.12
R9609:Tlr3 UTSW 8 45,850,117 (GRCm39) missense probably benign 0.02
R9731:Tlr3 UTSW 8 45,850,944 (GRCm39) missense probably damaging 1.00
Z1177:Tlr3 UTSW 8 45,851,020 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGATGTCAATGAAATAAGCCG -3'
(R):5'- AAGGTACATCACGCAGTTCAG -3'

Sequencing Primer
(F):5'- GCCGAAATATTTCAAAACTGAGATTG -3'
(R):5'- CGCAGTTCAGCAAGCTATTG -3'
Posted On 2020-10-20