Mutagenetix > Incidental Mutation

Incidental Mutation 'R8411:Tlr3'

652682

Institutional Source

Beutler Lab

Gene Symbol

Tlr3

Ensembl Gene

ENSMUSG00000031639

Gene Name

toll-like receptor 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_126166; MGI: 2156367

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R8411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45395665-45411080 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 45396941 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 897 (A897V)

Ref Sequence

ENSEMBL: ENSMUSP00000034056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034056] [ENSMUST00000167106] [ENSMUST00000209772] [ENSMUST00000210013]

AlphaFold

Q99MB1

PDB Structure

Crystal structure of mouse TLR3 ectodomain [X-RAY DIFFRACTION]
Mouse Toll-like receptor 3 ectodomain complexed with double-stranded RNA [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034056
AA Change: A897V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034056
Gene: ENSMUSG00000031639
AA Change: A897V

Domain	Start	End	E-Value	Type
LRRNT	28	56	1.14e1	SMART
LRR	50	74	1.33e1	SMART
LRR_TYP	99	122	4.72e-2	SMART
LRR	123	146	2.47e2	SMART
LRR	171	194	3.36e1	SMART
LRR	198	220	7.57e0	SMART
low complexity region	224	238	N/A	INTRINSIC
low complexity region	252	263	N/A	INTRINSIC
LRR	274	297	1.06e1	SMART
LRR_TYP	298	321	1.28e-3	SMART
LRR	355	378	6.23e1	SMART
LRR	379	404	3.18e2	SMART
LRR	405	430	8.98e1	SMART
LRR	431	455	6.78e1	SMART
LRR_TYP	506	529	1.79e-2	SMART
LRR	530	553	2.63e0	SMART
LRR_TYP	562	585	1.56e-2	SMART
LRR	586	609	1.37e1	SMART
LRR	611	633	8.48e0	SMART
LRRCT	646	698	1.07e-10	SMART
transmembrane domain	705	724	N/A	INTRINSIC
TIR	756	901	2.43e-26	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167106
AA Change: A897V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126556
Gene: ENSMUSG00000031639
AA Change: A897V

Domain	Start	End	E-Value	Type
LRRNT	28	56	1.14e1	SMART
LRR	50	74	1.33e1	SMART
LRR_TYP	99	122	4.72e-2	SMART
LRR	123	146	2.47e2	SMART
LRR	171	194	3.36e1	SMART
LRR	198	220	7.57e0	SMART
low complexity region	224	238	N/A	INTRINSIC
low complexity region	252	263	N/A	INTRINSIC
LRR	274	297	1.06e1	SMART
LRR_TYP	298	321	1.28e-3	SMART
LRR	355	378	6.23e1	SMART
LRR	379	404	3.18e2	SMART
LRR	405	430	8.98e1	SMART
LRR	431	455	6.78e1	SMART
LRR_TYP	506	529	1.79e-2	SMART
LRR	530	553	2.63e0	SMART
LRR_TYP	562	585	1.56e-2	SMART
LRR	586	609	1.37e1	SMART
LRR	611	633	8.48e0	SMART
LRRCT	646	698	1.07e-10	SMART
transmembrane domain	705	724	N/A	INTRINSIC
TIR	756	901	2.43e-26	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000209772
AA Change: A897V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000210013

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses. Use of alternative polyadenylation sites to generate different length transcripts has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show alterations in innate immunity against different viruses, viral pathogenesis, anxiety, hippocampal synaptic plasticity, memory retention and neurogenesis. Homozygotes for another null allele show altered ds-RNA responses in dendritic and aorta smooth muscle cells. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,137,722	S89P	probably benign	Het
Aatf	A	T	11: 84,470,676	M367K	probably benign	Het
Adam18	A	T	8: 24,652,127	I211N	probably damaging	Het
Angpt1	T	C	15: 42,427,034	Y478C	probably damaging	Het
Apba2	A	T	7: 64,736,926	I434F	probably damaging	Het
Arfgef1	T	A	1: 10,216,534	K50N	probably benign	Het
Arfgef2	A	T	2: 166,873,983	Q1397H	probably benign	Het
Ascc2	G	A	11: 4,647,208	R129Q	probably damaging	Het
Atxn1	A	G	13: 45,566,556	V621A	probably benign	Het
Catsperz	A	T	19: 6,922,562	L192M	probably benign	Het
Cd5	G	A	19: 10,720,221	P465S	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cfap61	A	G	2: 145,947,183	E94G	probably benign	Het
Chd1	A	G	17: 15,762,449	H1392R	probably damaging	Het
Csnk1a1	A	G	18: 61,555,817	I23V	probably benign	Het
Ctnnd2	C	T	15: 30,647,033	R292C	probably benign	Het
Dcaf6	T	A	1: 165,388,675	H453L	probably benign	Het
Dnah3	C	A	7: 120,011,030	D1728Y	probably damaging	Het
Dtx3	T	C	10: 127,192,824	K179E	possibly damaging	Het
Fam3b	T	A	16: 97,481,853	Y74F	probably benign	Het
Gm5464	T	C	14: 66,869,106	L64P	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Kcnh7	T	A	2: 62,764,608	H706L	probably damaging	Het
Kdm2b	C	T	5: 122,880,176	R1067H	probably damaging	Het
Klhl28	A	T	12: 64,950,090	H492Q	probably damaging	Het
Loxl3	T	A	6: 83,050,624	C716S	probably damaging	Het
Ltbp2	A	G	12: 84,786,413	Y1474H	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Mmp24	G	T	2: 155,814,015	V458L	probably benign	Het
Mpl	C	A	4: 118,446,109	S502I		Het
Nfatc1	A	T	18: 80,667,042	V503D	probably damaging	Het
Nim1k	A	G	13: 119,714,271	I133T	possibly damaging	Het
Nr1d2	T	C	14: 18,215,031	Y327C	probably damaging	Het
Olfr1214	T	C	2: 88,988,065	T46A	probably benign	Het
Oma1	C	T	4: 103,328,916	R360*	probably null	Het
Oog2	T	A	4: 144,194,173	W59R	probably damaging	Het
Pcdh10	A	G	3: 45,379,539	E96G	probably damaging	Het
Pcna	T	A	2: 132,251,930	T98S	probably benign	Het
Pcnx3	C	T	19: 5,679,590	C899Y	possibly damaging	Het
Phf11d	T	C	14: 59,356,434	N97S	probably benign	Het
Plekhg4	G	A	8: 105,377,329	W431*	probably null	Het
Plk4	A	G	3: 40,813,466	T815A	probably benign	Het
Pnma2	C	T	14: 66,916,313	T62I	possibly damaging	Het
Ppp1r9a	C	T	6: 5,057,568	R548W	probably damaging	Het
Ptx3	A	G	3: 66,224,780	S241G	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rplp0	A	T	5: 115,560,764	K26N	probably damaging	Het
Sec62	A	C	3: 30,818,782	E338A	unknown	Het
Sema6a	T	C	18: 47,248,955	M842V	probably benign	Het
Serpina3j	T	C	12: 104,314,784	V72A	probably benign	Het
Siglecf	T	C	7: 43,351,944	F112S	probably damaging	Het
Slc29a4	A	G	5: 142,720,125	N455D	probably damaging	Het
Slc6a11	T	A	6: 114,131,437	F54Y	probably benign	Het
Spag6	G	A	2: 18,710,583	V80M	probably damaging	Het
Spic	T	C	10: 88,678,636	E34G	possibly damaging	Het
Tecpr2	A	G	12: 110,931,720	K469E	possibly damaging	Het
Them7	T	A	2: 105,297,845	L57Q	probably benign	Het
Tnp2	A	G	16: 10,788,508	C32R	possibly damaging	Het
Trpm6	A	T	19: 18,853,968	Q1399L	probably benign	Het
Ttn	C	A	2: 76,846,671	E11074*	probably null	Het
Ubash3b	G	A	9: 41,043,485	A243V	probably benign	Het
Vash1	G	A	12: 86,680,178	R64Q	possibly damaging	Het
Vmn1r167	T	A	7: 23,505,556	M12L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,581	H645L	probably benign	Het
Vmn2r75	A	T	7: 86,148,514	I697K	probably damaging	Het
Vmn2r87	A	G	10: 130,472,257	I704T	probably damaging	Het

Other mutations in Tlr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Tlr3	APN	8	45400690	missense	probably damaging	0.99
IGL01820:Tlr3	APN	8	45398339	missense	probably benign
IGL02504:Tlr3	APN	8	45397907	missense	probably damaging	1.00
IGL02523:Tlr3	APN	8	45398391	splice site	probably null
IGL03166:Tlr3	APN	8	45402928	missense	probably benign	0.05
IGL03287:Tlr3	APN	8	45402780	missense	probably benign
Rakshasa	UTSW	8	45397697	missense	probably benign	0.08
Ultraman	UTSW	8	45402981	missense	probably damaging	1.00
E0354:Tlr3	UTSW	8	45400820	missense	probably damaging	1.00
R0960:Tlr3	UTSW	8	45397415	missense	probably damaging	1.00
R1175:Tlr3	UTSW	8	45397134	missense	probably damaging	1.00
R1332:Tlr3	UTSW	8	45398737	missense	probably damaging	0.99
R1477:Tlr3	UTSW	8	45398165	missense	probably damaging	1.00
R1667:Tlr3	UTSW	8	45400837	missense	probably benign	0.00
R1755:Tlr3	UTSW	8	45397973	missense	probably benign
R1996:Tlr3	UTSW	8	45397697	missense	probably benign	0.08
R2012:Tlr3	UTSW	8	45402786	missense	possibly damaging	0.91
R2288:Tlr3	UTSW	8	45397668	missense	probably damaging	0.98
R2895:Tlr3	UTSW	8	45397592	missense	possibly damaging	0.89
R3837:Tlr3	UTSW	8	45396939	missense	probably damaging	1.00
R4905:Tlr3	UTSW	8	45399223	critical splice acceptor site	probably null
R4934:Tlr3	UTSW	8	45397035	missense	probably benign	0.10
R5025:Tlr3	UTSW	8	45403038	missense	probably benign	0.00
R5086:Tlr3	UTSW	8	45402825	missense	probably damaging	0.96
R5129:Tlr3	UTSW	8	45402981	missense	probably damaging	1.00
R5320:Tlr3	UTSW	8	45399100	missense	possibly damaging	0.95
R5411:Tlr3	UTSW	8	45396955	missense	probably benign	0.01
R5497:Tlr3	UTSW	8	45398814	missense	possibly damaging	0.60
R5498:Tlr3	UTSW	8	45398814	missense	possibly damaging	0.60
R5499:Tlr3	UTSW	8	45398814	missense	possibly damaging	0.60
R5501:Tlr3	UTSW	8	45398814	missense	possibly damaging	0.60
R5731:Tlr3	UTSW	8	45398120	missense	probably benign	0.00
R5761:Tlr3	UTSW	8	45402771	missense	probably benign	0.00
R5992:Tlr3	UTSW	8	45397814	missense	probably benign
R6031:Tlr3	UTSW	8	45398528	missense	probably damaging	1.00
R6031:Tlr3	UTSW	8	45398528	missense	probably damaging	1.00
R6104:Tlr3	UTSW	8	45403093	missense	probably benign	0.00
R6289:Tlr3	UTSW	8	45396929	missense	probably benign	0.04
R6372:Tlr3	UTSW	8	45397011	missense	probably damaging	1.00
R6470:Tlr3	UTSW	8	45397385	missense	probably damaging	1.00
R6486:Tlr3	UTSW	8	45398613	splice site	probably null
R6504:Tlr3	UTSW	8	45397449	missense	possibly damaging	0.79
R6721:Tlr3	UTSW	8	45398880	missense	probably benign	0.00
R7089:Tlr3	UTSW	8	45397773	missense	probably benign	0.02
R7169:Tlr3	UTSW	8	45397019	missense	probably damaging	1.00
R7679:Tlr3	UTSW	8	45399051	missense	probably benign
R7771:Tlr3	UTSW	8	45403039	missense	probably benign
R7863:Tlr3	UTSW	8	45397737	missense	probably benign	0.00
R7896:Tlr3	UTSW	8	45397053	nonsense	probably null
R8009:Tlr3	UTSW	8	45400782	missense	not run
R8219:Tlr3	UTSW	8	45397979	missense	possibly damaging	0.95
R8397:Tlr3	UTSW	8	45398859	missense	possibly damaging	0.94
R8539:Tlr3	UTSW	8	45398516	missense	probably damaging	1.00
R8786:Tlr3	UTSW	8	45398249	missense	possibly damaging	0.94
R8916:Tlr3	UTSW	8	45403039	missense	probably benign
R9282:Tlr3	UTSW	8	45398606	missense	probably benign	0.12
R9609:Tlr3	UTSW	8	45397080	missense	probably benign	0.02
R9731:Tlr3	UTSW	8	45397907	missense	probably damaging	1.00
Z1177:Tlr3	UTSW	8	45397983	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCAGATGTCAATGAAATAAGCCG -3'
(R):5'- AAGGTACATCACGCAGTTCAG -3'

Sequencing Primer
(F):5'- GCCGAAATATTTCAAAACTGAGATTG -3'
(R):5'- CGCAGTTCAGCAAGCTATTG -3'

Posted On

2020-10-20