Incidental Mutation 'R8411:Plekhg4'
ID 652683
Institutional Source Beutler Lab
Gene Symbol Plekhg4
Ensembl Gene ENSMUSG00000014782
Gene Name pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms 4931414L13Rik
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.176) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 106099906-106109494 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 106103961 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 431 (W431*)
Ref Sequence ENSEMBL: ENSMUSP00000150574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000160650] [ENSMUST00000214056]
AlphaFold A0A1L1SU27
Predicted Effect probably null
Transcript: ENSMUST00000014927
AA Change: W395*
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782
AA Change: W395*

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000160191
AA Change: W326*
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782
AA Change: W326*

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160650
Predicted Effect probably null
Transcript: ENSMUST00000214056
AA Change: W431*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can function as a guanine nucleotide exchange factor (GEF) and may play a role in intracellular signaling and cytoskeleton dynamics at the Golgi apparatus. Polymorphisms in the region of this gene have been found to be associated with spinocerebellar ataxia in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Plekhg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Plekhg4 APN 8 106,102,370 (GRCm39) missense probably benign 0.01
IGL00970:Plekhg4 APN 8 106,105,067 (GRCm39) missense probably benign 0.02
IGL01784:Plekhg4 APN 8 106,105,589 (GRCm39) missense probably damaging 1.00
IGL02063:Plekhg4 APN 8 106,105,884 (GRCm39) splice site probably benign
IGL02371:Plekhg4 APN 8 106,105,691 (GRCm39) splice site probably null
IGL02984:Plekhg4 UTSW 8 106,107,020 (GRCm39) missense probably damaging 1.00
R0013:Plekhg4 UTSW 8 106,102,028 (GRCm39) nonsense probably null
R0105:Plekhg4 UTSW 8 106,108,644 (GRCm39) missense possibly damaging 0.65
R0105:Plekhg4 UTSW 8 106,108,644 (GRCm39) missense possibly damaging 0.65
R0631:Plekhg4 UTSW 8 106,105,934 (GRCm39) missense probably damaging 1.00
R1078:Plekhg4 UTSW 8 106,108,309 (GRCm39) nonsense probably null
R1201:Plekhg4 UTSW 8 106,108,305 (GRCm39) missense probably damaging 1.00
R1222:Plekhg4 UTSW 8 106,105,742 (GRCm39) missense probably benign 0.03
R1418:Plekhg4 UTSW 8 106,105,742 (GRCm39) missense probably benign 0.03
R1459:Plekhg4 UTSW 8 106,108,431 (GRCm39) missense probably damaging 0.98
R1465:Plekhg4 UTSW 8 106,107,672 (GRCm39) splice site probably benign
R1558:Plekhg4 UTSW 8 106,108,467 (GRCm39) missense possibly damaging 0.73
R1637:Plekhg4 UTSW 8 106,108,413 (GRCm39) missense probably benign 0.08
R1757:Plekhg4 UTSW 8 106,108,293 (GRCm39) missense probably damaging 0.99
R1922:Plekhg4 UTSW 8 106,105,017 (GRCm39) missense probably damaging 1.00
R1961:Plekhg4 UTSW 8 106,108,096 (GRCm39) missense probably damaging 0.99
R2074:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R2113:Plekhg4 UTSW 8 106,106,066 (GRCm39) missense probably damaging 1.00
R2124:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R2196:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R2321:Plekhg4 UTSW 8 106,104,172 (GRCm39) missense probably benign 0.00
R2432:Plekhg4 UTSW 8 106,108,468 (GRCm39) missense probably benign 0.00
R2908:Plekhg4 UTSW 8 106,107,493 (GRCm39) missense probably damaging 1.00
R2910:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R4179:Plekhg4 UTSW 8 106,108,030 (GRCm39) missense possibly damaging 0.93
R4180:Plekhg4 UTSW 8 106,108,030 (GRCm39) missense possibly damaging 0.93
R4513:Plekhg4 UTSW 8 106,107,034 (GRCm39) missense probably damaging 1.00
R4678:Plekhg4 UTSW 8 106,107,003 (GRCm39) nonsense probably null
R4946:Plekhg4 UTSW 8 106,108,628 (GRCm39) missense probably null 0.01
R5223:Plekhg4 UTSW 8 106,105,581 (GRCm39) missense probably benign 0.18
R5362:Plekhg4 UTSW 8 106,108,030 (GRCm39) missense possibly damaging 0.93
R5454:Plekhg4 UTSW 8 106,102,745 (GRCm39) critical splice donor site probably null
R5609:Plekhg4 UTSW 8 106,106,134 (GRCm39) critical splice donor site probably null
R5624:Plekhg4 UTSW 8 106,107,382 (GRCm39) missense probably damaging 0.99
R5806:Plekhg4 UTSW 8 106,105,542 (GRCm39) missense possibly damaging 0.85
R6297:Plekhg4 UTSW 8 106,104,472 (GRCm39) missense probably damaging 1.00
R7198:Plekhg4 UTSW 8 106,105,329 (GRCm39) missense probably damaging 1.00
R7443:Plekhg4 UTSW 8 106,107,499 (GRCm39) missense probably damaging 1.00
R7570:Plekhg4 UTSW 8 106,105,316 (GRCm39) missense possibly damaging 0.95
R7577:Plekhg4 UTSW 8 106,102,031 (GRCm39) missense probably benign
R7632:Plekhg4 UTSW 8 106,106,782 (GRCm39) missense probably damaging 1.00
R7782:Plekhg4 UTSW 8 106,104,399 (GRCm39) missense probably benign 0.14
R7958:Plekhg4 UTSW 8 106,103,281 (GRCm39) missense possibly damaging 0.86
R8239:Plekhg4 UTSW 8 106,107,546 (GRCm39) nonsense probably null
R8335:Plekhg4 UTSW 8 106,102,848 (GRCm39) missense probably damaging 0.97
R9011:Plekhg4 UTSW 8 106,102,284 (GRCm39) missense probably benign 0.23
R9017:Plekhg4 UTSW 8 106,105,332 (GRCm39) missense possibly damaging 0.85
R9255:Plekhg4 UTSW 8 106,103,271 (GRCm39) missense probably benign 0.00
R9297:Plekhg4 UTSW 8 106,105,907 (GRCm39) missense probably damaging 1.00
R9391:Plekhg4 UTSW 8 106,106,043 (GRCm39) missense probably damaging 1.00
R9524:Plekhg4 UTSW 8 106,101,398 (GRCm39) missense unknown
R9613:Plekhg4 UTSW 8 106,107,620 (GRCm39) missense probably damaging 1.00
R9683:Plekhg4 UTSW 8 106,102,923 (GRCm39) missense probably benign 0.00
Z1177:Plekhg4 UTSW 8 106,101,474 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGTATGAAGGCACTGCGG -3'
(R):5'- TTGTGCTCTGACAGTCCTG -3'

Sequencing Primer
(F):5'- AGTGAGTGTCCCTCCCAAGTC -3'
(R):5'- GTTTCTCCACTCTGTTATGCTGGG -3'
Posted On 2020-10-20