Incidental Mutation 'R8411:Dtx3'
ID 652686
Institutional Source Beutler Lab
Gene Symbol Dtx3
Ensembl Gene ENSMUSG00000040415
Gene Name deltex 3, E3 ubiquitin ligase
Synonyms
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.369) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 127026247-127031597 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127028693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 179 (K179E)
Ref Sequence ENSEMBL: ENSMUSP00000111937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013970] [ENSMUST00000019611] [ENSMUST00000038217] [ENSMUST00000116229] [ENSMUST00000130855] [ENSMUST00000137151] [ENSMUST00000144322] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000219245] [ENSMUST00000222006]
AlphaFold Q80V91
Predicted Effect probably benign
Transcript: ENSMUST00000013970
SMART Domains Protein: ENSMUSP00000013970
Gene: ENSMUSG00000025417

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
PIPKc 72 420 2.3e-172 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019611
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000038217
AA Change: K179E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044627
Gene: ENSMUSG00000040415
AA Change: K179E

DomainStartEndE-ValueType
low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116229
AA Change: K179E

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111937
Gene: ENSMUSG00000040415
AA Change: K179E

DomainStartEndE-ValueType
low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130855
AA Change: K182E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114776
Gene: ENSMUSG00000040415
AA Change: K182E

DomainStartEndE-ValueType
low complexity region 67 75 N/A INTRINSIC
coiled coil region 76 107 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
RING 167 205 1.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137151
Predicted Effect probably benign
Transcript: ENSMUST00000144322
SMART Domains Protein: ENSMUSP00000116510
Gene: ENSMUSG00000040415

DomainStartEndE-ValueType
low complexity region 67 75 N/A INTRINSIC
coiled coil region 76 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167353
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect probably benign
Transcript: ENSMUST00000218654
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect probably benign
Transcript: ENSMUST00000222006
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX3 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Dtx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Dtx3 APN 10 127,029,148 (GRCm39) missense probably damaging 0.99
IGL02314:Dtx3 APN 10 127,026,828 (GRCm39) unclassified probably benign
R0257:Dtx3 UTSW 10 127,028,761 (GRCm39) missense probably benign
R1108:Dtx3 UTSW 10 127,027,158 (GRCm39) missense possibly damaging 0.84
R1422:Dtx3 UTSW 10 127,027,158 (GRCm39) missense possibly damaging 0.84
R3693:Dtx3 UTSW 10 127,027,293 (GRCm39) missense probably benign 0.33
R4016:Dtx3 UTSW 10 127,027,040 (GRCm39) missense probably benign 0.00
R4231:Dtx3 UTSW 10 127,029,058 (GRCm39) missense possibly damaging 0.92
R4232:Dtx3 UTSW 10 127,029,058 (GRCm39) missense possibly damaging 0.92
R4236:Dtx3 UTSW 10 127,029,058 (GRCm39) missense possibly damaging 0.92
R4590:Dtx3 UTSW 10 127,028,564 (GRCm39) missense probably damaging 0.99
R4838:Dtx3 UTSW 10 127,027,176 (GRCm39) splice site probably null
R5338:Dtx3 UTSW 10 127,028,919 (GRCm39) missense probably benign 0.23
R5510:Dtx3 UTSW 10 127,028,807 (GRCm39) missense probably benign 0.08
R6989:Dtx3 UTSW 10 127,028,746 (GRCm39) missense probably benign 0.01
R7225:Dtx3 UTSW 10 127,027,358 (GRCm39) missense probably damaging 0.99
R8137:Dtx3 UTSW 10 127,029,041 (GRCm39) missense possibly damaging 0.85
R8293:Dtx3 UTSW 10 127,026,882 (GRCm39) missense probably damaging 1.00
R9080:Dtx3 UTSW 10 127,027,137 (GRCm39) missense possibly damaging 0.68
R9663:Dtx3 UTSW 10 127,028,518 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACTTCTCGTAGCTGGGCAG -3'
(R):5'- TCTCAAGGGGCTACTGAAAGAG -3'

Sequencing Primer
(F):5'- CAGCAGGAGGGTGGCATC -3'
(R):5'- AGCTCATGGGCTGCCTG -3'
Posted On 2020-10-20