Incidental Mutation 'R8411:Vmn2r87'
ID 652687
Institutional Source Beutler Lab
Gene Symbol Vmn2r87
Ensembl Gene ENSMUSG00000091511
Gene Name vomeronasal 2, receptor 87
Synonyms EG625131
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 130307690-130333248 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130308126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 704 (I704T)
Ref Sequence ENSEMBL: ENSMUSP00000129215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164227]
AlphaFold E9PZX4
Predicted Effect probably damaging
Transcript: ENSMUST00000164227
AA Change: I704T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129215
Gene: ENSMUSG00000091511
AA Change: I704T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 422 1.8e-27 PFAM
Pfam:NCD3G 508 562 1.8e-19 PFAM
Pfam:7tm_3 595 829 8.8e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Other mutations in Vmn2r87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r87 APN 10 130,333,247 (GRCm39) start codon destroyed probably null 1.00
IGL01295:Vmn2r87 APN 10 130,307,878 (GRCm39) missense probably damaging 1.00
IGL01411:Vmn2r87 APN 10 130,308,429 (GRCm39) missense probably benign 0.03
IGL01680:Vmn2r87 APN 10 130,315,586 (GRCm39) nonsense probably null
IGL01822:Vmn2r87 APN 10 130,307,991 (GRCm39) missense probably damaging 1.00
IGL01835:Vmn2r87 APN 10 130,314,978 (GRCm39) missense probably damaging 1.00
IGL01965:Vmn2r87 APN 10 130,314,924 (GRCm39) missense possibly damaging 0.49
IGL02562:Vmn2r87 APN 10 130,314,513 (GRCm39) missense probably damaging 1.00
IGL02665:Vmn2r87 APN 10 130,333,049 (GRCm39) missense probably benign 0.16
IGL03202:Vmn2r87 APN 10 130,333,091 (GRCm39) missense probably benign
FR4304:Vmn2r87 UTSW 10 130,314,583 (GRCm39) missense probably benign 0.01
FR4340:Vmn2r87 UTSW 10 130,314,583 (GRCm39) missense probably benign 0.01
FR4342:Vmn2r87 UTSW 10 130,314,583 (GRCm39) missense probably benign 0.01
FR4589:Vmn2r87 UTSW 10 130,314,583 (GRCm39) missense probably benign 0.01
LCD18:Vmn2r87 UTSW 10 130,314,583 (GRCm39) missense probably benign 0.01
R0344:Vmn2r87 UTSW 10 130,315,806 (GRCm39) missense probably damaging 1.00
R0374:Vmn2r87 UTSW 10 130,307,848 (GRCm39) missense probably damaging 1.00
R0384:Vmn2r87 UTSW 10 130,307,712 (GRCm39) missense probably benign
R1144:Vmn2r87 UTSW 10 130,312,098 (GRCm39) splice site probably benign
R1172:Vmn2r87 UTSW 10 130,313,453 (GRCm39) missense probably benign 0.03
R1860:Vmn2r87 UTSW 10 130,315,755 (GRCm39) missense probably benign 0.00
R1866:Vmn2r87 UTSW 10 130,308,441 (GRCm39) missense possibly damaging 0.88
R1897:Vmn2r87 UTSW 10 130,307,829 (GRCm39) missense probably damaging 1.00
R2360:Vmn2r87 UTSW 10 130,315,631 (GRCm39) missense probably damaging 0.99
R2909:Vmn2r87 UTSW 10 130,314,865 (GRCm39) missense probably damaging 0.99
R3874:Vmn2r87 UTSW 10 130,315,856 (GRCm39) missense possibly damaging 0.62
R4113:Vmn2r87 UTSW 10 130,315,691 (GRCm39) missense probably benign
R4190:Vmn2r87 UTSW 10 130,308,556 (GRCm39) missense probably damaging 1.00
R4197:Vmn2r87 UTSW 10 130,315,779 (GRCm39) missense possibly damaging 0.55
R4201:Vmn2r87 UTSW 10 130,308,448 (GRCm39) missense probably benign 0.03
R4202:Vmn2r87 UTSW 10 130,308,448 (GRCm39) missense probably benign 0.03
R4368:Vmn2r87 UTSW 10 130,315,676 (GRCm39) missense probably benign 0.44
R4485:Vmn2r87 UTSW 10 130,315,678 (GRCm39) nonsense probably null
R4537:Vmn2r87 UTSW 10 130,308,054 (GRCm39) missense probably benign 0.12
R4590:Vmn2r87 UTSW 10 130,315,014 (GRCm39) missense possibly damaging 0.69
R4752:Vmn2r87 UTSW 10 130,314,336 (GRCm39) nonsense probably null
R4873:Vmn2r87 UTSW 10 130,308,367 (GRCm39) missense probably damaging 1.00
R4875:Vmn2r87 UTSW 10 130,308,367 (GRCm39) missense probably damaging 1.00
R4923:Vmn2r87 UTSW 10 130,314,435 (GRCm39) missense probably damaging 0.99
R4970:Vmn2r87 UTSW 10 130,314,422 (GRCm39) missense probably damaging 1.00
R5049:Vmn2r87 UTSW 10 130,308,298 (GRCm39) missense probably damaging 0.96
R5112:Vmn2r87 UTSW 10 130,314,422 (GRCm39) missense probably damaging 1.00
R5187:Vmn2r87 UTSW 10 130,333,208 (GRCm39) missense probably null 0.99
R5618:Vmn2r87 UTSW 10 130,315,817 (GRCm39) missense probably damaging 1.00
R6057:Vmn2r87 UTSW 10 130,308,226 (GRCm39) missense probably benign 0.02
R6220:Vmn2r87 UTSW 10 130,315,807 (GRCm39) missense probably benign 0.01
R6287:Vmn2r87 UTSW 10 130,314,291 (GRCm39) critical splice donor site probably null
R6383:Vmn2r87 UTSW 10 130,314,869 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r87 UTSW 10 130,314,654 (GRCm39) missense probably benign 0.05
R6742:Vmn2r87 UTSW 10 130,308,396 (GRCm39) missense probably damaging 1.00
R7086:Vmn2r87 UTSW 10 130,333,178 (GRCm39) missense probably benign 0.00
R7162:Vmn2r87 UTSW 10 130,313,416 (GRCm39) missense probably benign 0.08
R7419:Vmn2r87 UTSW 10 130,307,992 (GRCm39) missense probably damaging 1.00
R7425:Vmn2r87 UTSW 10 130,314,761 (GRCm39) missense probably damaging 1.00
R7443:Vmn2r87 UTSW 10 130,308,588 (GRCm39) missense probably damaging 1.00
R7571:Vmn2r87 UTSW 10 130,314,940 (GRCm39) missense probably damaging 0.99
R7663:Vmn2r87 UTSW 10 130,308,054 (GRCm39) missense probably damaging 0.97
R7716:Vmn2r87 UTSW 10 130,308,018 (GRCm39) missense probably benign 0.09
R7793:Vmn2r87 UTSW 10 130,313,413 (GRCm39) missense probably benign 0.05
R7806:Vmn2r87 UTSW 10 130,315,679 (GRCm39) missense probably benign
R7841:Vmn2r87 UTSW 10 130,333,095 (GRCm39) missense probably benign 0.31
R8326:Vmn2r87 UTSW 10 130,308,180 (GRCm39) missense possibly damaging 0.67
R8445:Vmn2r87 UTSW 10 130,313,335 (GRCm39) missense probably damaging 1.00
R8540:Vmn2r87 UTSW 10 130,314,762 (GRCm39) missense possibly damaging 0.74
R8892:Vmn2r87 UTSW 10 130,308,105 (GRCm39) missense probably damaging 0.99
R9093:Vmn2r87 UTSW 10 130,308,165 (GRCm39) missense probably benign 0.08
R9623:Vmn2r87 UTSW 10 130,315,794 (GRCm39) missense probably damaging 1.00
R9667:Vmn2r87 UTSW 10 130,314,776 (GRCm39) missense probably damaging 1.00
R9797:Vmn2r87 UTSW 10 130,312,064 (GRCm39) missense probably benign 0.44
R9797:Vmn2r87 UTSW 10 130,308,138 (GRCm39) missense probably damaging 0.99
Z1088:Vmn2r87 UTSW 10 130,308,183 (GRCm39) missense probably damaging 0.98
Z1176:Vmn2r87 UTSW 10 130,307,713 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACACCAGCATGCTGAAAGTTAG -3'
(R):5'- TTGAACATCCCAACCAGGTC -3'

Sequencing Primer
(F):5'- GCTTCATTGAATCTGTCAGGAAG -3'
(R):5'- AGGTCACCTGCATCCTGC -3'
Posted On 2020-10-20