Incidental Mutation 'R8411:Aatf'
ID 652689
Institutional Source Beutler Lab
Gene Symbol Aatf
Ensembl Gene ENSMUSG00000018697
Gene Name apoptosis antagonizing transcription factor
Synonyms Trb, 4933415H02Rik, 5830465M17Rik, Che-1
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_019816.1; MGI:1929608
Essential gene? Essential (E-score: 1.000) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84422855-84513522 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84470676 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 367 (M367K)
Ref Sequence ENSEMBL: ENSMUSP00000018841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018841]
AlphaFold Q9JKX4
Predicted Effect probably benign
Transcript: ENSMUST00000018841
AA Change: M367K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000018841
Gene: ENSMUSG00000018697
AA Change: M367K

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 91 119 N/A INTRINSIC
low complexity region 130 173 N/A INTRINSIC
Pfam:AATF-Che1 187 339 4.6e-40 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:TRAUB 430 514 3.2e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 2176283
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos do not develop past the compacted morula stage, and after failing to maintain compaction. Mutant embryos show abnormal morphology at E3.5, with most not forming a blastocoel cavity. Severely reduced cell proliferation is observed before blastocyst formation. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(2) Gene trapped(18) 
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,137,722 S89P probably benign Het
Adam18 A T 8: 24,652,127 I211N probably damaging Het
Angpt1 T C 15: 42,427,034 Y478C probably damaging Het
Apba2 A T 7: 64,736,926 I434F probably damaging Het
Arfgef1 T A 1: 10,216,534 K50N probably benign Het
Arfgef2 A T 2: 166,873,983 Q1397H probably benign Het
Ascc2 G A 11: 4,647,208 R129Q probably damaging Het
Atxn1 A G 13: 45,566,556 V621A probably benign Het
Catsperz A T 19: 6,922,562 L192M probably benign Het
Cd5 G A 19: 10,720,221 P465S probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cfap61 A G 2: 145,947,183 E94G probably benign Het
Chd1 A G 17: 15,762,449 H1392R probably damaging Het
Csnk1a1 A G 18: 61,555,817 I23V probably benign Het
Ctnnd2 C T 15: 30,647,033 R292C probably benign Het
Dcaf6 T A 1: 165,388,675 H453L probably benign Het
Dnah3 C A 7: 120,011,030 D1728Y probably damaging Het
Dtx3 T C 10: 127,192,824 K179E possibly damaging Het
Fam3b T A 16: 97,481,853 Y74F probably benign Het
Gm5464 T C 14: 66,869,106 L64P unknown Het
Gm5624 T G 14: 44,561,890 N70T Het
Kcnh7 T A 2: 62,764,608 H706L probably damaging Het
Kdm2b C T 5: 122,880,176 R1067H probably damaging Het
Klhl28 A T 12: 64,950,090 H492Q probably damaging Het
Loxl3 T A 6: 83,050,624 C716S probably damaging Het
Ltbp2 A G 12: 84,786,413 Y1474H probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Mmp24 G T 2: 155,814,015 V458L probably benign Het
Mpl C A 4: 118,446,109 S502I Het
Nfatc1 A T 18: 80,667,042 V503D probably damaging Het
Nim1k A G 13: 119,714,271 I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 Y327C probably damaging Het
Olfr1214 T C 2: 88,988,065 T46A probably benign Het
Oma1 C T 4: 103,328,916 R360* probably null Het
Oog2 T A 4: 144,194,173 W59R probably damaging Het
Pcdh10 A G 3: 45,379,539 E96G probably damaging Het
Pcna T A 2: 132,251,930 T98S probably benign Het
Pcnx3 C T 19: 5,679,590 C899Y possibly damaging Het
Phf11d T C 14: 59,356,434 N97S probably benign Het
Plekhg4 G A 8: 105,377,329 W431* probably null Het
Plk4 A G 3: 40,813,466 T815A probably benign Het
Pnma2 C T 14: 66,916,313 T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 R548W probably damaging Het
Ptx3 A G 3: 66,224,780 S241G probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rplp0 A T 5: 115,560,764 K26N probably damaging Het
Sec62 A C 3: 30,818,782 E338A unknown Het
Sema6a T C 18: 47,248,955 M842V probably benign Het
Serpina3j T C 12: 104,314,784 V72A probably benign Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc29a4 A G 5: 142,720,125 N455D probably damaging Het
Slc6a11 T A 6: 114,131,437 F54Y probably benign Het
Spag6 G A 2: 18,710,583 V80M probably damaging Het
Spic T C 10: 88,678,636 E34G possibly damaging Het
Tecpr2 A G 12: 110,931,720 K469E possibly damaging Het
Them7 T A 2: 105,297,845 L57Q probably benign Het
Tlr3 G A 8: 45,396,941 A897V probably damaging Het
Tnp2 A G 16: 10,788,508 C32R possibly damaging Het
Trpm6 A T 19: 18,853,968 Q1399L probably benign Het
Ttn C A 2: 76,846,671 E11074* probably null Het
Ubash3b G A 9: 41,043,485 A243V probably benign Het
Vash1 G A 12: 86,680,178 R64Q possibly damaging Het
Vmn1r167 T A 7: 23,505,556 M12L possibly damaging Het
Vmn2r111 T A 17: 22,548,581 H645L probably benign Het
Vmn2r75 A T 7: 86,148,514 I697K probably damaging Het
Vmn2r87 A G 10: 130,472,257 I704T probably damaging Het
Other mutations in Aatf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Aatf APN 11 84470557 splice site probably benign
IGL01482:Aatf APN 11 84470710 missense possibly damaging 0.51
IGL01775:Aatf APN 11 84471137 missense probably damaging 1.00
IGL02881:Aatf APN 11 84471289 splice site probably benign
R0183:Aatf UTSW 11 84510425 splice site probably null
R0200:Aatf UTSW 11 84445676 missense probably damaging 1.00
R0257:Aatf UTSW 11 84510281 missense probably benign 0.33
R0324:Aatf UTSW 11 84512139 critical splice donor site probably null
R0494:Aatf UTSW 11 84511513 missense probably benign
R0544:Aatf UTSW 11 84423005 missense probably benign 0.09
R1186:Aatf UTSW 11 84470549 splice site probably benign
R2339:Aatf UTSW 11 84511497 missense probably benign 0.00
R4626:Aatf UTSW 11 84422958 makesense probably null
R4647:Aatf UTSW 11 84471197 missense possibly damaging 0.69
R4697:Aatf UTSW 11 84449138 missense probably damaging 1.00
R4981:Aatf UTSW 11 84511497 missense probably benign 0.00
R5490:Aatf UTSW 11 84510273 missense probably damaging 1.00
R5938:Aatf UTSW 11 84442574 missense possibly damaging 0.88
R6267:Aatf UTSW 11 84473100 missense probably benign 0.09
R6296:Aatf UTSW 11 84473100 missense probably benign 0.09
R6633:Aatf UTSW 11 84511482 critical splice donor site probably null
R7081:Aatf UTSW 11 84471125 missense possibly damaging 0.84
R7212:Aatf UTSW 11 84449180 missense probably damaging 0.98
R7545:Aatf UTSW 11 84470676 missense probably benign 0.04
R7754:Aatf UTSW 11 84511509 missense possibly damaging 0.53
R7871:Aatf UTSW 11 84471038 frame shift probably null
R8746:Aatf UTSW 11 84511512 missense probably benign 0.06
R9406:Aatf UTSW 11 84471040 frame shift probably null
X0018:Aatf UTSW 11 84510385 missense possibly damaging 0.85
Z1176:Aatf UTSW 11 84442585 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCGTTCCTCACAGAAAGAGC -3'
(R):5'- TTCTGAGAACTGTGGTAGGCATAC -3'

Sequencing Primer
(F):5'- AAGAGCTCATTCTGCAGGCTG -3'
(R):5'- ACTGTGGTAGGCATACTCAGC -3'
Posted On 2020-10-20