Incidental Mutation 'R8411:Ltbp2'
ID 652691
Institutional Source Beutler Lab
Gene Symbol Ltbp2
Ensembl Gene ENSMUSG00000002020
Gene Name latent transforming growth factor beta binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.796) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 84783212-84876532 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84786413 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1474 (Y1474H)
Ref Sequence ENSEMBL: ENSMUSP00000105883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002073] [ENSMUST00000110254] [ENSMUST00000163189] [ENSMUST00000166383]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002073
AA Change: Y1497H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002073
Gene: ENSMUSG00000002020
AA Change: Y1497H

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
EGF 184 213 6.55e-1 SMART
low complexity region 255 275 N/A INTRINSIC
EGF 384 413 8.19e-2 SMART
low complexity region 515 526 N/A INTRINSIC
Pfam:TB 546 582 3.8e-9 PFAM
EGF_CA 606 646 8.05e-10 SMART
Pfam:TB 666 707 3.4e-17 PFAM
EGF_CA 832 874 7.18e-7 SMART
EGF_CA 875 917 1.75e-10 SMART
EGF_CA 918 957 1.53e-10 SMART
EGF_CA 958 997 3.51e-10 SMART
EGF_CA 998 1038 8.3e-12 SMART
EGF_CA 1039 1080 4.56e-9 SMART
EGF_CA 1081 1122 4.56e-9 SMART
EGF_CA 1123 1163 8.76e-11 SMART
EGF_CA 1164 1205 4.38e-11 SMART
EGF_CA 1206 1246 1.75e-10 SMART
EGF_CA 1247 1290 2.24e-8 SMART
EGF_CA 1291 1332 6.01e-9 SMART
EGF 1336 1375 1.95e1 SMART
Pfam:TB 1410 1450 1.4e-13 PFAM
EGF_CA 1473 1515 2.31e-10 SMART
EGF_CA 1516 1555 7.93e-9 SMART
Pfam:TB 1582 1623 1e-13 PFAM
low complexity region 1691 1704 N/A INTRINSIC
EGF 1724 1761 4e-5 SMART
EGF_CA 1762 1806 1.91e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110254
AA Change: Y1474H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105883
Gene: ENSMUSG00000002020
AA Change: Y1474H

DomainStartEndE-ValueType
low complexity region 119 128 N/A INTRINSIC
EGF 204 233 6.55e-1 SMART
low complexity region 275 295 N/A INTRINSIC
EGF 404 433 8.19e-2 SMART
low complexity region 535 546 N/A INTRINSIC
Pfam:TB 565 602 4e-8 PFAM
EGF_CA 626 666 8.05e-10 SMART
Pfam:TB 685 727 3.7e-16 PFAM
EGF_CA 852 894 7.18e-7 SMART
EGF_CA 895 934 1.53e-10 SMART
EGF_CA 935 974 3.51e-10 SMART
EGF_CA 975 1015 8.3e-12 SMART
EGF_CA 1016 1057 4.56e-9 SMART
EGF_CA 1058 1099 4.56e-9 SMART
EGF_CA 1100 1140 8.76e-11 SMART
EGF_CA 1141 1182 4.38e-11 SMART
EGF_CA 1183 1223 1.75e-10 SMART
EGF_CA 1224 1267 2.24e-8 SMART
EGF_CA 1268 1309 6.01e-9 SMART
EGF 1313 1352 1.95e1 SMART
Pfam:TB 1387 1427 1.4e-11 PFAM
EGF_CA 1450 1492 2.31e-10 SMART
EGF_CA 1493 1532 7.93e-9 SMART
Pfam:TB 1558 1600 4.6e-13 PFAM
low complexity region 1668 1681 N/A INTRINSIC
EGF 1701 1738 4e-5 SMART
EGF_CA 1739 1783 1.91e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163189
AA Change: Y1454H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127693
Gene: ENSMUSG00000002020
AA Change: Y1454H

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
EGF 184 213 6.55e-1 SMART
low complexity region 255 275 N/A INTRINSIC
EGF 384 413 8.19e-2 SMART
low complexity region 515 526 N/A INTRINSIC
Pfam:TB 545 582 4e-8 PFAM
EGF_CA 606 646 8.05e-10 SMART
Pfam:TB 665 707 3.8e-16 PFAM
EGF_CA 832 874 7.18e-7 SMART
EGF_CA 875 914 1.53e-10 SMART
EGF_CA 915 954 3.51e-10 SMART
EGF_CA 955 995 8.3e-12 SMART
EGF_CA 996 1037 4.56e-9 SMART
EGF_CA 1038 1079 4.56e-9 SMART
EGF_CA 1080 1120 8.76e-11 SMART
EGF_CA 1121 1162 4.38e-11 SMART
EGF_CA 1163 1203 1.75e-10 SMART
EGF_CA 1204 1247 2.24e-8 SMART
EGF_CA 1248 1289 6.01e-9 SMART
EGF 1293 1332 1.95e1 SMART
Pfam:TB 1367 1407 1.5e-11 PFAM
EGF_CA 1430 1472 2.31e-10 SMART
EGF_CA 1473 1512 7.93e-9 SMART
Pfam:TB 1538 1580 4.7e-13 PFAM
low complexity region 1648 1661 N/A INTRINSIC
EGF 1681 1718 4e-5 SMART
EGF_CA 1719 1763 1.91e-11 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000132067
Gene: ENSMUSG00000002020
AA Change: Y296H

DomainStartEndE-ValueType
EGF_CA 6 46 8.76e-11 SMART
EGF_CA 47 90 2.24e-8 SMART
EGF_CA 91 132 6.01e-9 SMART
EGF 136 175 1.95e1 SMART
Pfam:TB 210 250 1.5e-14 PFAM
EGF 276 307 1.5e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166383
SMART Domains Protein: ENSMUSP00000127255
Gene: ENSMUSG00000002020

DomainStartEndE-ValueType
EGF_CA 8 49 2.13e-9 SMART
Pfam:TB 75 117 1.3e-14 PFAM
low complexity region 185 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent transforming growth factor (TGF)-beta binding proteins (LTBP), which are extracellular matrix proteins with multi-domain structure. This protein is the largest member of the LTBP family possessing unique regions and with most similarity to the fibrillins. It has thus been suggested that it may have multiple functions: as a member of the TGF-beta latent complex, as a structural component of microfibrils, and a role in cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early embryonic lethality prior to E6.5. Mice homozygous for a different null allele are viable, fertile, and developmentally normal but develop lens dislocations due to ciliary zonule fragmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,137,722 S89P probably benign Het
Aatf A T 11: 84,470,676 M367K probably benign Het
Adam18 A T 8: 24,652,127 I211N probably damaging Het
Angpt1 T C 15: 42,427,034 Y478C probably damaging Het
Apba2 A T 7: 64,736,926 I434F probably damaging Het
Arfgef1 T A 1: 10,216,534 K50N probably benign Het
Arfgef2 A T 2: 166,873,983 Q1397H probably benign Het
Ascc2 G A 11: 4,647,208 R129Q probably damaging Het
Atxn1 A G 13: 45,566,556 V621A probably benign Het
Catsperz A T 19: 6,922,562 L192M probably benign Het
Cd5 G A 19: 10,720,221 P465S probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cfap61 A G 2: 145,947,183 E94G probably benign Het
Chd1 A G 17: 15,762,449 H1392R probably damaging Het
Csnk1a1 A G 18: 61,555,817 I23V probably benign Het
Ctnnd2 C T 15: 30,647,033 R292C probably benign Het
Dcaf6 T A 1: 165,388,675 H453L probably benign Het
Dnah3 C A 7: 120,011,030 D1728Y probably damaging Het
Dtx3 T C 10: 127,192,824 K179E possibly damaging Het
Fam3b T A 16: 97,481,853 Y74F probably benign Het
Gm5464 T C 14: 66,869,106 L64P unknown Het
Gm5624 T G 14: 44,561,890 N70T Het
Kcnh7 T A 2: 62,764,608 H706L probably damaging Het
Kdm2b C T 5: 122,880,176 R1067H probably damaging Het
Klhl28 A T 12: 64,950,090 H492Q probably damaging Het
Loxl3 T A 6: 83,050,624 C716S probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Mmp24 G T 2: 155,814,015 V458L probably benign Het
Mpl C A 4: 118,446,109 S502I Het
Nfatc1 A T 18: 80,667,042 V503D probably damaging Het
Nim1k A G 13: 119,714,271 I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 Y327C probably damaging Het
Olfr1214 T C 2: 88,988,065 T46A probably benign Het
Oma1 C T 4: 103,328,916 R360* probably null Het
Oog2 T A 4: 144,194,173 W59R probably damaging Het
Pcdh10 A G 3: 45,379,539 E96G probably damaging Het
Pcna T A 2: 132,251,930 T98S probably benign Het
Pcnx3 C T 19: 5,679,590 C899Y possibly damaging Het
Phf11d T C 14: 59,356,434 N97S probably benign Het
Plekhg4 G A 8: 105,377,329 W431* probably null Het
Plk4 A G 3: 40,813,466 T815A probably benign Het
Pnma2 C T 14: 66,916,313 T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 R548W probably damaging Het
Ptx3 A G 3: 66,224,780 S241G probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rplp0 A T 5: 115,560,764 K26N probably damaging Het
Sec62 A C 3: 30,818,782 E338A unknown Het
Sema6a T C 18: 47,248,955 M842V probably benign Het
Serpina3j T C 12: 104,314,784 V72A probably benign Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc29a4 A G 5: 142,720,125 N455D probably damaging Het
Slc6a11 T A 6: 114,131,437 F54Y probably benign Het
Spag6 G A 2: 18,710,583 V80M probably damaging Het
Spic T C 10: 88,678,636 E34G possibly damaging Het
Tecpr2 A G 12: 110,931,720 K469E possibly damaging Het
Them7 T A 2: 105,297,845 L57Q probably benign Het
Tlr3 G A 8: 45,396,941 A897V probably damaging Het
Tnp2 A G 16: 10,788,508 C32R possibly damaging Het
Trpm6 A T 19: 18,853,968 Q1399L probably benign Het
Ttn C A 2: 76,846,671 E11074* probably null Het
Ubash3b G A 9: 41,043,485 A243V probably benign Het
Vash1 G A 12: 86,680,178 R64Q possibly damaging Het
Vmn1r167 T A 7: 23,505,556 M12L possibly damaging Het
Vmn2r111 T A 17: 22,548,581 H645L probably benign Het
Vmn2r75 A T 7: 86,148,514 I697K probably damaging Het
Vmn2r87 A G 10: 130,472,257 I704T probably damaging Het
Other mutations in Ltbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Ltbp2 APN 12 84791064 missense probably damaging 1.00
IGL00938:Ltbp2 APN 12 84831799 missense probably benign 0.03
IGL01397:Ltbp2 APN 12 84790268 missense probably damaging 1.00
IGL01570:Ltbp2 APN 12 84794033 missense probably benign 0.05
IGL01631:Ltbp2 APN 12 84809146 critical splice donor site probably null
IGL01662:Ltbp2 APN 12 84809246 missense probably benign 0.00
IGL01728:Ltbp2 APN 12 84791009 missense probably damaging 0.99
IGL01839:Ltbp2 APN 12 84793658 missense possibly damaging 0.48
IGL01946:Ltbp2 APN 12 84830748 missense probably damaging 1.00
IGL01977:Ltbp2 APN 12 84830199 missense probably damaging 1.00
IGL02220:Ltbp2 APN 12 84829309 missense possibly damaging 0.93
IGL02340:Ltbp2 APN 12 84792955 critical splice donor site probably null
IGL02430:Ltbp2 APN 12 84799401 missense probably damaging 1.00
IGL02492:Ltbp2 APN 12 84809665 missense probably damaging 1.00
IGL02517:Ltbp2 APN 12 84785317 missense probably benign 0.42
IGL02794:Ltbp2 APN 12 84791935 missense probably damaging 1.00
deft UTSW 12 84853912 missense probably damaging 0.98
masterful UTSW 12 84791090 missense probably benign 0.00
practiced UTSW 12 84809348 missense probably damaging 1.00
R0045:Ltbp2 UTSW 12 84809587 missense probably damaging 1.00
R0045:Ltbp2 UTSW 12 84813288 missense probably damaging 1.00
R0091:Ltbp2 UTSW 12 84793733 missense probably damaging 1.00
R0094:Ltbp2 UTSW 12 84799426 missense probably damaging 1.00
R0166:Ltbp2 UTSW 12 84786358 missense probably benign 0.28
R0265:Ltbp2 UTSW 12 84785969 splice site probably null
R0394:Ltbp2 UTSW 12 84806424 splice site probably benign
R0535:Ltbp2 UTSW 12 84784858 missense probably damaging 1.00
R0535:Ltbp2 UTSW 12 84791052 missense probably damaging 1.00
R1465:Ltbp2 UTSW 12 84813300 missense probably damaging 1.00
R1465:Ltbp2 UTSW 12 84813300 missense probably damaging 1.00
R1513:Ltbp2 UTSW 12 84791944 missense probably damaging 1.00
R1858:Ltbp2 UTSW 12 84830781 nonsense probably null
R1880:Ltbp2 UTSW 12 84829271 missense probably benign 0.45
R1894:Ltbp2 UTSW 12 84787961 missense probably damaging 1.00
R1900:Ltbp2 UTSW 12 84830658 missense probably damaging 1.00
R1903:Ltbp2 UTSW 12 84830105 missense probably benign 0.01
R1912:Ltbp2 UTSW 12 84785863 missense probably damaging 0.98
R1993:Ltbp2 UTSW 12 84808446 critical splice acceptor site probably null
R1995:Ltbp2 UTSW 12 84808446 critical splice acceptor site probably null
R2069:Ltbp2 UTSW 12 84793733 missense probably damaging 1.00
R2126:Ltbp2 UTSW 12 84785709 splice site probably null
R2139:Ltbp2 UTSW 12 84815979 missense probably damaging 1.00
R2341:Ltbp2 UTSW 12 84809163 missense probably benign 0.08
R2511:Ltbp2 UTSW 12 84804409 splice site probably null
R3737:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3738:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3739:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3889:Ltbp2 UTSW 12 84784907 unclassified probably benign
R4034:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R4542:Ltbp2 UTSW 12 84831819 nonsense probably null
R4621:Ltbp2 UTSW 12 84809348 missense probably damaging 1.00
R4623:Ltbp2 UTSW 12 84809348 missense probably damaging 1.00
R4831:Ltbp2 UTSW 12 84793640 missense possibly damaging 0.55
R5080:Ltbp2 UTSW 12 84803864 missense probably damaging 1.00
R5116:Ltbp2 UTSW 12 84809737 missense probably damaging 1.00
R5351:Ltbp2 UTSW 12 84790358 missense possibly damaging 0.95
R5445:Ltbp2 UTSW 12 84809654 missense probably null 1.00
R5608:Ltbp2 UTSW 12 84787464 splice site probably null
R5784:Ltbp2 UTSW 12 84868739 missense probably damaging 1.00
R5838:Ltbp2 UTSW 12 84789101 missense probably benign 0.16
R5859:Ltbp2 UTSW 12 84794063 missense possibly damaging 0.52
R6004:Ltbp2 UTSW 12 84876149 missense probably benign 0.00
R6028:Ltbp2 UTSW 12 84784852 missense probably damaging 1.00
R6347:Ltbp2 UTSW 12 84853912 missense probably damaging 0.98
R6615:Ltbp2 UTSW 12 84813317 missense probably damaging 1.00
R6636:Ltbp2 UTSW 12 84875838 missense probably benign 0.00
R6637:Ltbp2 UTSW 12 84875838 missense probably benign 0.00
R6755:Ltbp2 UTSW 12 84795073 missense probably damaging 1.00
R6759:Ltbp2 UTSW 12 84787410 missense probably damaging 0.99
R6806:Ltbp2 UTSW 12 84809238 missense possibly damaging 0.74
R6968:Ltbp2 UTSW 12 84789083 critical splice donor site probably null
R7084:Ltbp2 UTSW 12 84868685 missense probably damaging 1.00
R7250:Ltbp2 UTSW 12 84787392 nonsense probably null
R7374:Ltbp2 UTSW 12 84830175 missense probably damaging 1.00
R7501:Ltbp2 UTSW 12 84830645 missense probably damaging 1.00
R7523:Ltbp2 UTSW 12 84791034 missense probably benign 0.00
R7754:Ltbp2 UTSW 12 84813238 critical splice donor site probably null
R7827:Ltbp2 UTSW 12 84789881 missense probably benign 0.19
R8042:Ltbp2 UTSW 12 84791899 missense probably damaging 0.99
R8110:Ltbp2 UTSW 12 84803902 nonsense probably null
R8688:Ltbp2 UTSW 12 84803804 missense probably benign 0.20
R8711:Ltbp2 UTSW 12 84853741 missense probably benign 0.00
R8712:Ltbp2 UTSW 12 84806350 missense probably benign 0.08
R8893:Ltbp2 UTSW 12 84828542 missense probably damaging 1.00
R8978:Ltbp2 UTSW 12 84787390 missense probably benign 0.00
R9016:Ltbp2 UTSW 12 84809693 missense probably benign 0.02
R9123:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9129:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9132:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9144:Ltbp2 UTSW 12 84809652 missense probably damaging 1.00
R9150:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9152:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9156:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9157:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9158:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9159:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9160:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9199:Ltbp2 UTSW 12 84785976 missense probably benign 0.09
R9212:Ltbp2 UTSW 12 84793050 missense probably damaging 1.00
R9275:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9276:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9276:Ltbp2 UTSW 12 84830111 missense possibly damaging 0.79
R9278:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9279:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9280:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9281:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9312:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9313:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9331:Ltbp2 UTSW 12 84876191 missense probably benign
R9355:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9375:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9377:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9378:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9450:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9457:Ltbp2 UTSW 12 84789153 missense probably benign 0.19
R9486:Ltbp2 UTSW 12 84831874 missense possibly damaging 0.49
R9505:Ltbp2 UTSW 12 84853864 missense probably damaging 1.00
R9512:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9581:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9582:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9645:Ltbp2 UTSW 12 84791090 missense probably benign 0.00
R9747:Ltbp2 UTSW 12 84868741 missense probably damaging 1.00
R9792:Ltbp2 UTSW 12 84829354 missense probably damaging 0.99
R9795:Ltbp2 UTSW 12 84829354 missense probably damaging 0.99
X0017:Ltbp2 UTSW 12 84828528 missense probably damaging 1.00
X0026:Ltbp2 UTSW 12 84830199 missense probably damaging 1.00
Z1176:Ltbp2 UTSW 12 84875853 missense probably benign 0.01
Z1177:Ltbp2 UTSW 12 84829316 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TAGAACTGCCCTTGCCTCAC -3'
(R):5'- GGTGCCTTATTGAGAAAGCTAGTC -3'

Sequencing Primer
(F):5'- ACACCCACCTGCTGCAGTG -3'
(R):5'- GCCGATGAATGTGTACTG -3'
Posted On 2020-10-20