Incidental Mutation 'R8411:Atxn1'
ID 652695
Institutional Source Beutler Lab
Gene Symbol Atxn1
Ensembl Gene ENSMUSG00000046876
Gene Name ataxin 1
Synonyms 2900016G23Rik, Atx1, Sca1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 45549755-45965008 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45566556 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 621 (V621A)
Ref Sequence ENSEMBL: ENSMUSP00000137439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091628] [ENSMUST00000167708] [ENSMUST00000180110]
AlphaFold P54254
Predicted Effect probably benign
Transcript: ENSMUST00000091628
SMART Domains Protein: ENSMUSP00000089217
Gene: ENSMUSG00000046876

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167708
SMART Domains Protein: ENSMUSP00000129890
Gene: ENSMUSG00000046876

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180110
AA Change: V621A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137439
Gene: ENSMUSG00000046876
AA Change: V621A

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 402 421 3e-10 PFAM
low complexity region 537 548 N/A INTRINSIC
Pfam:AXH 550 671 1.1e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). At least two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased exploration, impaired spatial working memory, impaired coordination, and decreased paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,137,722 S89P probably benign Het
Aatf A T 11: 84,470,676 M367K probably benign Het
Adam18 A T 8: 24,652,127 I211N probably damaging Het
Angpt1 T C 15: 42,427,034 Y478C probably damaging Het
Apba2 A T 7: 64,736,926 I434F probably damaging Het
Arfgef1 T A 1: 10,216,534 K50N probably benign Het
Arfgef2 A T 2: 166,873,983 Q1397H probably benign Het
Ascc2 G A 11: 4,647,208 R129Q probably damaging Het
Catsperz A T 19: 6,922,562 L192M probably benign Het
Cd5 G A 19: 10,720,221 P465S probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cfap61 A G 2: 145,947,183 E94G probably benign Het
Chd1 A G 17: 15,762,449 H1392R probably damaging Het
Csnk1a1 A G 18: 61,555,817 I23V probably benign Het
Ctnnd2 C T 15: 30,647,033 R292C probably benign Het
Dcaf6 T A 1: 165,388,675 H453L probably benign Het
Dnah3 C A 7: 120,011,030 D1728Y probably damaging Het
Dtx3 T C 10: 127,192,824 K179E possibly damaging Het
Fam3b T A 16: 97,481,853 Y74F probably benign Het
Gm5464 T C 14: 66,869,106 L64P unknown Het
Gm5624 T G 14: 44,561,890 N70T Het
Kcnh7 T A 2: 62,764,608 H706L probably damaging Het
Kdm2b C T 5: 122,880,176 R1067H probably damaging Het
Klhl28 A T 12: 64,950,090 H492Q probably damaging Het
Loxl3 T A 6: 83,050,624 C716S probably damaging Het
Ltbp2 A G 12: 84,786,413 Y1474H probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Mmp24 G T 2: 155,814,015 V458L probably benign Het
Mpl C A 4: 118,446,109 S502I Het
Nfatc1 A T 18: 80,667,042 V503D probably damaging Het
Nim1k A G 13: 119,714,271 I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 Y327C probably damaging Het
Olfr1214 T C 2: 88,988,065 T46A probably benign Het
Oma1 C T 4: 103,328,916 R360* probably null Het
Oog2 T A 4: 144,194,173 W59R probably damaging Het
Pcdh10 A G 3: 45,379,539 E96G probably damaging Het
Pcna T A 2: 132,251,930 T98S probably benign Het
Pcnx3 C T 19: 5,679,590 C899Y possibly damaging Het
Phf11d T C 14: 59,356,434 N97S probably benign Het
Plekhg4 G A 8: 105,377,329 W431* probably null Het
Plk4 A G 3: 40,813,466 T815A probably benign Het
Pnma2 C T 14: 66,916,313 T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 R548W probably damaging Het
Ptx3 A G 3: 66,224,780 S241G probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rplp0 A T 5: 115,560,764 K26N probably damaging Het
Sec62 A C 3: 30,818,782 E338A unknown Het
Sema6a T C 18: 47,248,955 M842V probably benign Het
Serpina3j T C 12: 104,314,784 V72A probably benign Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc29a4 A G 5: 142,720,125 N455D probably damaging Het
Slc6a11 T A 6: 114,131,437 F54Y probably benign Het
Spag6 G A 2: 18,710,583 V80M probably damaging Het
Spic T C 10: 88,678,636 E34G possibly damaging Het
Tecpr2 A G 12: 110,931,720 K469E possibly damaging Het
Them7 T A 2: 105,297,845 L57Q probably benign Het
Tlr3 G A 8: 45,396,941 A897V probably damaging Het
Tnp2 A G 16: 10,788,508 C32R possibly damaging Het
Trpm6 A T 19: 18,853,968 Q1399L probably benign Het
Ttn C A 2: 76,846,671 E11074* probably null Het
Ubash3b G A 9: 41,043,485 A243V probably benign Het
Vash1 G A 12: 86,680,178 R64Q possibly damaging Het
Vmn1r167 T A 7: 23,505,556 M12L possibly damaging Het
Vmn2r111 T A 17: 22,548,581 H645L probably benign Het
Vmn2r75 A T 7: 86,148,514 I697K probably damaging Het
Vmn2r87 A G 10: 130,472,257 I704T probably damaging Het
Other mutations in Atxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Atxn1 APN 13 45568427 utr 5 prime probably benign
IGL01467:Atxn1 APN 13 45567193 missense probably damaging 1.00
IGL01482:Atxn1 APN 13 45557314 missense probably benign 0.00
IGL01512:Atxn1 APN 13 45566601 missense probably damaging 0.99
IGL01735:Atxn1 APN 13 45566722 missense probably damaging 1.00
IGL02005:Atxn1 APN 13 45568225 missense probably benign 0.00
IGL02333:Atxn1 APN 13 45567204 missense probably damaging 1.00
Cormorant UTSW 13 45557069 missense probably damaging 1.00
pelagic UTSW 13 45566812 missense probably benign 0.05
R0136:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0180:Atxn1 UTSW 13 45557548 missense probably damaging 1.00
R0299:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0540:Atxn1 UTSW 13 45557530 missense probably damaging 1.00
R1220:Atxn1 UTSW 13 45557423 missense probably benign 0.08
R1484:Atxn1 UTSW 13 45557576 nonsense probably null
R1532:Atxn1 UTSW 13 45566910 missense possibly damaging 0.95
R1885:Atxn1 UTSW 13 45567804 missense probably benign 0.27
R2277:Atxn1 UTSW 13 45557068 missense probably damaging 0.99
R2847:Atxn1 UTSW 13 45566699 missense probably damaging 1.00
R2849:Atxn1 UTSW 13 45566699 missense probably damaging 1.00
R4326:Atxn1 UTSW 13 45965967 unclassified probably benign
R4626:Atxn1 UTSW 13 45567099 missense probably damaging 1.00
R4768:Atxn1 UTSW 13 45557548 missense probably damaging 1.00
R4944:Atxn1 UTSW 13 45566931 missense probably damaging 1.00
R5011:Atxn1 UTSW 13 45557069 missense probably damaging 1.00
R5061:Atxn1 UTSW 13 45557093 missense probably damaging 1.00
R5293:Atxn1 UTSW 13 45568368 missense probably damaging 1.00
R5299:Atxn1 UTSW 13 45557254 missense probably benign 0.14
R5561:Atxn1 UTSW 13 45566871 missense possibly damaging 0.49
R5667:Atxn1 UTSW 13 45557377 missense probably benign 0.17
R6092:Atxn1 UTSW 13 45566812 missense probably benign 0.05
R6272:Atxn1 UTSW 13 45567762 missense possibly damaging 0.49
R6372:Atxn1 UTSW 13 45557456 missense probably damaging 1.00
R6688:Atxn1 UTSW 13 45567671 missense probably damaging 0.99
R6997:Atxn1 UTSW 13 45567619 missense probably benign 0.04
R7041:Atxn1 UTSW 13 45566835 missense probably damaging 1.00
R7578:Atxn1 UTSW 13 45567358 missense probably benign 0.02
R7600:Atxn1 UTSW 13 45557060 missense possibly damaging 0.90
R8112:Atxn1 UTSW 13 45567957 missense probably benign
R8297:Atxn1 UTSW 13 45567029 missense probably benign
R8482:Atxn1 UTSW 13 45567950 missense possibly damaging 0.75
R9022:Atxn1 UTSW 13 45567415 missense probably damaging 1.00
R9269:Atxn1 UTSW 13 45557204 missense probably benign 0.01
R9310:Atxn1 UTSW 13 45568018 missense probably damaging 1.00
R9514:Atxn1 UTSW 13 45567957 missense probably benign
R9626:Atxn1 UTSW 13 45557320 missense possibly damaging 0.92
R9673:Atxn1 UTSW 13 45557146 missense probably benign 0.01
R9744:Atxn1 UTSW 13 45567823 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATACTATCTGTGGTGGCTCTCTC -3'
(R):5'- GAAAGGCTCCATCATCCAGC -3'

Sequencing Primer
(F):5'- GTGGCTCTCTCTTAAGGGAACTC -3'
(R):5'- ATCATCCAGCTGGCCAACGG -3'
Posted On 2020-10-20