Mutagenetix > Incidental Mutation

Incidental Mutation 'R8411:Ctnnd2'

652702

Institutional Source

Beutler Lab

Gene Symbol

Ctnnd2

Ensembl Gene

ENSMUSG00000022240

Gene Name

catenin (cadherin associated protein), delta 2

Synonyms

Catnd2, neurojugin, Nprap

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_008729.2; MGI:1195966

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8411 (G1)

Quality Score

103.008

Status

Not validated

Chromosome

Chromosomal Location

30172593-31029341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30647033 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 292 (R292C)

Ref Sequence

ENSEMBL: ENSMUSP00000080427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081728] [ENSMUST00000226116] [ENSMUST00000226119] [ENSMUST00000228282]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000081728
AA Change: R292C

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000080427
Gene: ENSMUSG00000022240
AA Change: R292C

Domain	Start	End	E-Value	Type
coiled coil region	50	84	N/A	INTRINSIC
low complexity region	87	97	N/A	INTRINSIC
low complexity region	148	159	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
low complexity region	238	257	N/A	INTRINSIC
ARM	577	617	1.85e-8	SMART
ARM	621	662	1.15e-9	SMART
ARM	663	720	1.51e1	SMART
ARM	722	769	2.74e1	SMART
ARM	830	871	4.88e0	SMART
ARM	902	942	2.76e-7	SMART
low complexity region	964	973	N/A	INTRINSIC
ARM	995	1039	5.64e-4	SMART
low complexity region	1086	1099	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226116

Predicted Effect

probably benign
Transcript: ENSMUST00000226119
AA Change: R292C

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000228282

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

Strain: 3056606
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adhesive junction associated protein of the armadillo/beta-catenin superfamily and is implicated in brain and eye development and cancer formation. The protein encoded by this gene promotes the disruption of E-cadherin based adherens junction to favor cell spreading upon stimulation by hepatocyte growth factor. This gene is overexpressed in prostate adenocarcinomas and is associated with decreased expression of tumor suppressor E-cadherin in this tissue. This gene resides in a region of the short arm of chromosome 5 that is deleted in Cri du Chat syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal conditioning, spatial learning and coordination behaviors and abnormal long term potentiation. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,137,722	S89P	probably benign	Het
Aatf	A	T	11: 84,470,676	M367K	probably benign	Het
Adam18	A	T	8: 24,652,127	I211N	probably damaging	Het
Angpt1	T	C	15: 42,427,034	Y478C	probably damaging	Het
Apba2	A	T	7: 64,736,926	I434F	probably damaging	Het
Arfgef1	T	A	1: 10,216,534	K50N	probably benign	Het
Arfgef2	A	T	2: 166,873,983	Q1397H	probably benign	Het
Ascc2	G	A	11: 4,647,208	R129Q	probably damaging	Het
Atxn1	A	G	13: 45,566,556	V621A	probably benign	Het
Catsperz	A	T	19: 6,922,562	L192M	probably benign	Het
Cd5	G	A	19: 10,720,221	P465S	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cfap61	A	G	2: 145,947,183	E94G	probably benign	Het
Chd1	A	G	17: 15,762,449	H1392R	probably damaging	Het
Csnk1a1	A	G	18: 61,555,817	I23V	probably benign	Het
Dcaf6	T	A	1: 165,388,675	H453L	probably benign	Het
Dnah3	C	A	7: 120,011,030	D1728Y	probably damaging	Het
Dtx3	T	C	10: 127,192,824	K179E	possibly damaging	Het
Fam3b	T	A	16: 97,481,853	Y74F	probably benign	Het
Gm5464	T	C	14: 66,869,106	L64P	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Kcnh7	T	A	2: 62,764,608	H706L	probably damaging	Het
Kdm2b	C	T	5: 122,880,176	R1067H	probably damaging	Het
Klhl28	A	T	12: 64,950,090	H492Q	probably damaging	Het
Loxl3	T	A	6: 83,050,624	C716S	probably damaging	Het
Ltbp2	A	G	12: 84,786,413	Y1474H	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Mmp24	G	T	2: 155,814,015	V458L	probably benign	Het
Mpl	C	A	4: 118,446,109	S502I		Het
Nfatc1	A	T	18: 80,667,042	V503D	probably damaging	Het
Nim1k	A	G	13: 119,714,271	I133T	possibly damaging	Het
Nr1d2	T	C	14: 18,215,031	Y327C	probably damaging	Het
Olfr1214	T	C	2: 88,988,065	T46A	probably benign	Het
Oma1	C	T	4: 103,328,916	R360*	probably null	Het
Oog2	T	A	4: 144,194,173	W59R	probably damaging	Het
Pcdh10	A	G	3: 45,379,539	E96G	probably damaging	Het
Pcna	T	A	2: 132,251,930	T98S	probably benign	Het
Pcnx3	C	T	19: 5,679,590	C899Y	possibly damaging	Het
Phf11d	T	C	14: 59,356,434	N97S	probably benign	Het
Plekhg4	G	A	8: 105,377,329	W431*	probably null	Het
Plk4	A	G	3: 40,813,466	T815A	probably benign	Het
Pnma2	C	T	14: 66,916,313	T62I	possibly damaging	Het
Ppp1r9a	C	T	6: 5,057,568	R548W	probably damaging	Het
Ptx3	A	G	3: 66,224,780	S241G	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rplp0	A	T	5: 115,560,764	K26N	probably damaging	Het
Sec62	A	C	3: 30,818,782	E338A	unknown	Het
Sema6a	T	C	18: 47,248,955	M842V	probably benign	Het
Serpina3j	T	C	12: 104,314,784	V72A	probably benign	Het
Siglecf	T	C	7: 43,351,944	F112S	probably damaging	Het
Slc29a4	A	G	5: 142,720,125	N455D	probably damaging	Het
Slc6a11	T	A	6: 114,131,437	F54Y	probably benign	Het
Spag6	G	A	2: 18,710,583	V80M	probably damaging	Het
Spic	T	C	10: 88,678,636	E34G	possibly damaging	Het
Tecpr2	A	G	12: 110,931,720	K469E	possibly damaging	Het
Them7	T	A	2: 105,297,845	L57Q	probably benign	Het
Tlr3	G	A	8: 45,396,941	A897V	probably damaging	Het
Tnp2	A	G	16: 10,788,508	C32R	possibly damaging	Het
Trpm6	A	T	19: 18,853,968	Q1399L	probably benign	Het
Ttn	C	A	2: 76,846,671	E11074*	probably null	Het
Ubash3b	G	A	9: 41,043,485	A243V	probably benign	Het
Vash1	G	A	12: 86,680,178	R64Q	possibly damaging	Het
Vmn1r167	T	A	7: 23,505,556	M12L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,581	H645L	probably benign	Het
Vmn2r75	A	T	7: 86,148,514	I697K	probably damaging	Het
Vmn2r87	A	G	10: 130,472,257	I704T	probably damaging	Het

Other mutations in Ctnnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00597:Ctnnd2	APN	15	30647141	missense	possibly damaging	0.73
IGL01612:Ctnnd2	APN	15	31005018	missense	probably damaging	1.00
IGL01923:Ctnnd2	APN	15	30480828	missense	probably damaging	0.99
IGL02183:Ctnnd2	APN	15	31020740	missense	probably damaging	1.00
IGL02186:Ctnnd2	APN	15	30480793	missense	probably damaging	0.99
IGL02226:Ctnnd2	APN	15	30847336	missense	probably benign	0.01
IGL02307:Ctnnd2	APN	15	30647211	missense	possibly damaging	0.86
IGL02407:Ctnnd2	APN	15	30966768	missense	probably damaging	1.00
IGL02474:Ctnnd2	APN	15	30669562	missense	possibly damaging	0.71
IGL02718:Ctnnd2	APN	15	31027616	missense	probably damaging	1.00
IGL03249:Ctnnd2	APN	15	30683236	missense	probably benign	0.45
IGL03328:Ctnnd2	APN	15	30921847	splice site	probably benign
carpe	UTSW	15	30905820	missense	probably damaging	1.00
diem	UTSW	15	30683347	missense	possibly damaging	0.85
P0016:Ctnnd2	UTSW	15	30966938	missense	probably benign	0.00
R0130:Ctnnd2	UTSW	15	30921913	missense	probably damaging	1.00
R0408:Ctnnd2	UTSW	15	30634677	missense	probably damaging	1.00
R0611:Ctnnd2	UTSW	15	31009084	missense	possibly damaging	0.75
R0894:Ctnnd2	UTSW	15	30332155	splice site	probably benign
R1112:Ctnnd2	UTSW	15	30921880	missense	probably damaging	1.00
R1459:Ctnnd2	UTSW	15	30847299	missense	probably damaging	1.00
R1529:Ctnnd2	UTSW	15	30887121	missense	possibly damaging	0.91
R1532:Ctnnd2	UTSW	15	30921868	missense	probably damaging	1.00
R1701:Ctnnd2	UTSW	15	30921981	missense	probably damaging	1.00
R1807:Ctnnd2	UTSW	15	30619871	missense	probably damaging	1.00
R1881:Ctnnd2	UTSW	15	31005081	splice site	probably benign
R1960:Ctnnd2	UTSW	15	30647111	missense	probably damaging	0.96
R2121:Ctnnd2	UTSW	15	30669514	missense	probably damaging	1.00
R3839:Ctnnd2	UTSW	15	31009028	splice site	probably null
R3967:Ctnnd2	UTSW	15	30646929	missense	possibly damaging	0.81
R3980:Ctnnd2	UTSW	15	30669443	missense	probably benign	0.14
R4207:Ctnnd2	UTSW	15	30972827	missense	probably damaging	0.99
R4279:Ctnnd2	UTSW	15	30905820	missense	probably damaging	1.00
R4498:Ctnnd2	UTSW	15	30619874	missense	probably damaging	1.00
R4622:Ctnnd2	UTSW	15	30887169	missense	probably benign	0.17
R4622:Ctnnd2	UTSW	15	31009113	missense	probably benign	0.00
R4860:Ctnnd2	UTSW	15	30881167	missense	probably damaging	1.00
R4860:Ctnnd2	UTSW	15	30881167	missense	probably damaging	1.00
R4979:Ctnnd2	UTSW	15	31009075	missense	probably damaging	1.00
R5086:Ctnnd2	UTSW	15	30683347	missense	possibly damaging	0.85
R5330:Ctnnd2	UTSW	15	30332115	missense	probably damaging	1.00
R5459:Ctnnd2	UTSW	15	30887188	missense	probably damaging	1.00
R5595:Ctnnd2	UTSW	15	30669543	missense	probably benign	0.07
R5809:Ctnnd2	UTSW	15	30847377	missense	probably damaging	1.00
R5987:Ctnnd2	UTSW	15	30683241	missense	probably benign
R6245:Ctnnd2	UTSW	15	30905748	missense	probably damaging	1.00
R6379:Ctnnd2	UTSW	15	30634698	missense	probably damaging	1.00
R6737:Ctnnd2	UTSW	15	30966834	nonsense	probably null
R6979:Ctnnd2	UTSW	15	30619230	missense	probably damaging	0.99
R7133:Ctnnd2	UTSW	15	30480849	missense	possibly damaging	0.47
R7179:Ctnnd2	UTSW	15	30683364	missense	possibly damaging	0.95
R7267:Ctnnd2	UTSW	15	30683355	missense	probably benign	0.13
R7275:Ctnnd2	UTSW	15	30905709	missense	possibly damaging	0.94
R7386:Ctnnd2	UTSW	15	30966768	missense	probably damaging	1.00
R7649:Ctnnd2	UTSW	15	31027484	missense	probably benign	0.11
R7814:Ctnnd2	UTSW	15	31020728	missense	probably benign	0.00
R7849:Ctnnd2	UTSW	15	31027587	missense	probably damaging	1.00
R7857:Ctnnd2	UTSW	15	30619930	missense	probably benign	0.01
R8057:Ctnnd2	UTSW	15	30847351	missense	possibly damaging	0.89
R8236:Ctnnd2	UTSW	15	30647018	missense	probably benign
R8260:Ctnnd2	UTSW	15	30634733	missense	possibly damaging	0.84
R8802:Ctnnd2	UTSW	15	30966876	missense	probably damaging	1.00
R8891:Ctnnd2	UTSW	15	30619930	missense	probably benign	0.01
R8907:Ctnnd2	UTSW	15	30905727	missense	probably damaging	1.00
R8989:Ctnnd2	UTSW	15	30669514	missense	probably damaging	1.00
R9017:Ctnnd2	UTSW	15	30881170	missense	probably damaging	0.96
R9035:Ctnnd2	UTSW	15	30332016	missense	possibly damaging	0.77
R9061:Ctnnd2	UTSW	15	30806738	missense	probably damaging	1.00
R9303:Ctnnd2	UTSW	15	30966891	missense	probably damaging	0.99
R9475:Ctnnd2	UTSW	15	30881130	missense	probably damaging	1.00
Z1088:Ctnnd2	UTSW	15	30966813	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TCTTGGAACTCGGAGCAGAC -3'
(R):5'- TGCTTGCTGTACTGCTCAGAC -3'

Sequencing Primer
(F):5'- AAGTTGTCTTCTGCAGCCG -3'
(R):5'- TGTACTGCTCAGACGCGTG -3'

Posted On

2020-10-20