Incidental Mutation 'R8411:Vmn2r111'
ID 652707
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22766922-22792254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22767562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 645 (H645L)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect probably benign
Transcript: ENSMUST00000092491
AA Change: H645L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: H645L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22,767,734 (GRCm39) missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22,787,965 (GRCm39) missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22,787,997 (GRCm39) missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22,790,966 (GRCm39) nonsense probably null
IGL01465:Vmn2r111 APN 17 22,767,718 (GRCm39) missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22,767,553 (GRCm39) missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22,790,373 (GRCm39) missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22,788,054 (GRCm39) splice site probably benign
IGL01962:Vmn2r111 APN 17 22,767,265 (GRCm39) missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22,789,754 (GRCm39) missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22,787,837 (GRCm39) missense probably benign
IGL02519:Vmn2r111 APN 17 22,767,320 (GRCm39) missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22,790,031 (GRCm39) missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22,792,205 (GRCm39) missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22,778,023 (GRCm39) critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22,790,226 (GRCm39) missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22,789,839 (GRCm39) missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22,766,990 (GRCm39) missense probably benign
R0064:Vmn2r111 UTSW 17 22,791,053 (GRCm39) missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22,792,102 (GRCm39) missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22,790,097 (GRCm39) missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22,790,380 (GRCm39) missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22,767,041 (GRCm39) missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22,767,062 (GRCm39) missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22,767,395 (GRCm39) missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22,778,043 (GRCm39) missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22,792,085 (GRCm39) missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22,778,151 (GRCm39) splice site probably benign
R3700:Vmn2r111 UTSW 17 22,790,142 (GRCm39) nonsense probably null
R3782:Vmn2r111 UTSW 17 22,790,301 (GRCm39) missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22,778,096 (GRCm39) missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22,792,159 (GRCm39) missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22,767,637 (GRCm39) missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22,767,022 (GRCm39) missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22,790,124 (GRCm39) missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22,790,001 (GRCm39) missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22,767,083 (GRCm39) nonsense probably null
R5398:Vmn2r111 UTSW 17 22,792,252 (GRCm39) start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22,767,470 (GRCm39) missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22,767,238 (GRCm39) missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6149:Vmn2r111 UTSW 17 22,767,796 (GRCm39) missense probably benign 0.00
R6207:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22,792,070 (GRCm39) missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22,790,889 (GRCm39) missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22,767,583 (GRCm39) missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22,790,226 (GRCm39) missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22,767,165 (GRCm39) missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22,767,695 (GRCm39) missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22,790,067 (GRCm39) missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22,767,380 (GRCm39) missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22,789,714 (GRCm39) missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22,792,083 (GRCm39) missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22,790,469 (GRCm39) missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22,792,073 (GRCm39) missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8539:Vmn2r111 UTSW 17 22,790,274 (GRCm39) missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22,778,024 (GRCm39) missense probably damaging 1.00
R8540:Vmn2r111 UTSW 17 22,778,023 (GRCm39) critical splice donor site probably null
R8557:Vmn2r111 UTSW 17 22,790,910 (GRCm39) nonsense probably null
R8720:Vmn2r111 UTSW 17 22,792,194 (GRCm39) missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22,767,239 (GRCm39) missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22,767,011 (GRCm39) missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22,790,822 (GRCm39) missense probably benign
R9374:Vmn2r111 UTSW 17 22,787,859 (GRCm39) missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22,778,132 (GRCm39) missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22,767,676 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGATGTAGTTAGATGCCCCTG -3'
(R):5'- ATTGTGCCCAGTGTCCAGAG -3'

Sequencing Primer
(F):5'- GTAGTTAGATGCCCCTGAAACTAG -3'
(R):5'- TTCTCAACTATGAAGAACCACTGGGG -3'
Posted On 2020-10-20