Incidental Mutation 'R8411:Nfatc1'
ID 652710
Institutional Source Beutler Lab
Gene Symbol Nfatc1
Ensembl Gene ENSMUSG00000033016
Gene Name nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
Synonyms 2210017P03Rik, NF-ATc, NFATc, NFAT2
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 80649420-80756286 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80710257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 503 (V503D)
Ref Sequence ENSEMBL: ENSMUSP00000129001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035800] [ENSMUST00000078049] [ENSMUST00000167977] [ENSMUST00000170905]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000035800
AA Change: V489D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046312
Gene: ENSMUSG00000033016
AA Change: V489D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 156 188 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Pfam:RHD 415 575 7.4e-28 PFAM
IPT 582 681 8.99e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078049
AA Change: V503D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077196
Gene: ENSMUSG00000033016
AA Change: V503D

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD 429 589 1.3e-27 PFAM
IPT 596 695 8.99e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167977
AA Change: V489D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126884
Gene: ENSMUSG00000033016
AA Change: V489D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 156 188 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Pfam:RHD 415 575 4.9e-28 PFAM
IPT 582 681 8.99e-21 SMART
low complexity region 832 841 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170905
AA Change: V503D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129001
Gene: ENSMUSG00000033016
AA Change: V503D

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD_DNA_bind 429 589 5.1e-28 PFAM
IPT 596 695 8.99e-21 SMART
low complexity region 846 855 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality throughout fetal growth and development due to cardiac failure. Mutants exhibit blood circulation, cardiac valve and ventricular septal abnormalities, edema, abdominal hemorrhage, and semilunar valveregurgitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Nfatc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Nfatc1 APN 18 80,710,241 (GRCm39) missense probably damaging 1.00
IGL00742:Nfatc1 APN 18 80,741,229 (GRCm39) missense probably benign 0.20
IGL01510:Nfatc1 APN 18 80,741,403 (GRCm39) missense probably damaging 1.00
IGL01790:Nfatc1 APN 18 80,710,257 (GRCm39) missense probably damaging 1.00
IGL02548:Nfatc1 APN 18 80,741,113 (GRCm39) missense probably damaging 1.00
goldfeld UTSW 18 80,741,047 (GRCm39) missense probably damaging 0.99
Instrumenten UTSW 18 80,725,406 (GRCm39) missense probably damaging 0.98
Original UTSW 18 80,696,779 (GRCm39) splice site probably null
BB003:Nfatc1 UTSW 18 80,740,881 (GRCm39) missense probably damaging 0.96
BB013:Nfatc1 UTSW 18 80,740,881 (GRCm39) missense probably damaging 0.96
R0019:Nfatc1 UTSW 18 80,678,719 (GRCm39) missense probably benign
R0411:Nfatc1 UTSW 18 80,741,257 (GRCm39) missense possibly damaging 0.88
R0738:Nfatc1 UTSW 18 80,741,125 (GRCm39) missense probably damaging 1.00
R0940:Nfatc1 UTSW 18 80,679,110 (GRCm39) missense probably benign 0.03
R1458:Nfatc1 UTSW 18 80,708,482 (GRCm39) splice site probably benign
R1622:Nfatc1 UTSW 18 80,710,182 (GRCm39) missense probably damaging 1.00
R1845:Nfatc1 UTSW 18 80,678,746 (GRCm39) missense possibly damaging 0.67
R2110:Nfatc1 UTSW 18 80,678,879 (GRCm39) nonsense probably null
R2112:Nfatc1 UTSW 18 80,678,879 (GRCm39) nonsense probably null
R2157:Nfatc1 UTSW 18 80,679,060 (GRCm39) missense possibly damaging 0.88
R3857:Nfatc1 UTSW 18 80,708,490 (GRCm39) splice site probably benign
R3859:Nfatc1 UTSW 18 80,708,490 (GRCm39) splice site probably benign
R4108:Nfatc1 UTSW 18 80,741,583 (GRCm39) missense possibly damaging 0.68
R4510:Nfatc1 UTSW 18 80,678,794 (GRCm39) missense probably damaging 0.96
R4511:Nfatc1 UTSW 18 80,678,794 (GRCm39) missense probably damaging 0.96
R4618:Nfatc1 UTSW 18 80,741,047 (GRCm39) missense probably damaging 0.99
R4850:Nfatc1 UTSW 18 80,741,080 (GRCm39) missense probably benign 0.30
R5329:Nfatc1 UTSW 18 80,751,332 (GRCm39) start codon destroyed probably null
R5395:Nfatc1 UTSW 18 80,679,235 (GRCm39) missense possibly damaging 0.80
R5468:Nfatc1 UTSW 18 80,693,070 (GRCm39) missense probably benign 0.00
R5522:Nfatc1 UTSW 18 80,696,744 (GRCm39) missense probably benign 0.36
R5568:Nfatc1 UTSW 18 80,693,037 (GRCm39) missense probably benign 0.12
R6111:Nfatc1 UTSW 18 80,741,125 (GRCm39) missense probably damaging 1.00
R6190:Nfatc1 UTSW 18 80,755,885 (GRCm39) missense probably benign 0.21
R6397:Nfatc1 UTSW 18 80,679,156 (GRCm39) missense probably damaging 1.00
R6943:Nfatc1 UTSW 18 80,678,770 (GRCm39) missense probably damaging 1.00
R6970:Nfatc1 UTSW 18 80,710,228 (GRCm39) missense probably benign 0.34
R6994:Nfatc1 UTSW 18 80,696,779 (GRCm39) splice site probably null
R7679:Nfatc1 UTSW 18 80,651,205 (GRCm39) missense probably benign
R7703:Nfatc1 UTSW 18 80,725,504 (GRCm39) missense probably damaging 1.00
R7926:Nfatc1 UTSW 18 80,740,881 (GRCm39) missense probably damaging 0.96
R8346:Nfatc1 UTSW 18 80,725,382 (GRCm39) missense probably benign 0.00
R8480:Nfatc1 UTSW 18 80,678,859 (GRCm39) missense probably benign 0.15
R8669:Nfatc1 UTSW 18 80,725,406 (GRCm39) missense probably damaging 0.98
R8928:Nfatc1 UTSW 18 80,741,180 (GRCm39) missense possibly damaging 0.82
R9194:Nfatc1 UTSW 18 80,751,258 (GRCm39) missense probably benign 0.04
R9281:Nfatc1 UTSW 18 80,741,190 (GRCm39) missense probably damaging 1.00
R9517:Nfatc1 UTSW 18 80,725,406 (GRCm39) missense probably damaging 0.98
R9562:Nfatc1 UTSW 18 80,678,916 (GRCm39) missense probably damaging 1.00
R9636:Nfatc1 UTSW 18 80,706,611 (GRCm39) missense possibly damaging 0.50
X0062:Nfatc1 UTSW 18 80,740,833 (GRCm39) missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCAGAAAGAGGCAAATCTGTCATC -3'
(R):5'- ACAAACAGTTGGTTCCCAGG -3'

Sequencing Primer
(F):5'- AAGTTTCTTCAGGCTCTAGAGAG -3'
(R):5'- AACAGTTGGTTCCCAGGATTTTATG -3'
Posted On 2020-10-20