Mutagenetix > Incidental Mutation

Incidental Mutation 'R8411:Nfatc1'

652710

Institutional Source

Beutler Lab

Gene Symbol

Nfatc1

Ensembl Gene

ENSMUSG00000033016

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1

Synonyms

NFATc, NFAT2, 2210017P03Rik, NF-ATc

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80606205-80713071 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80667042 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 503 (V503D)

Ref Sequence

ENSEMBL: ENSMUSP00000129001 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035800] [ENSMUST00000078049] [ENSMUST00000167977] [ENSMUST00000170905]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035800
AA Change: V489D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046312
Gene: ENSMUSG00000033016
AA Change: V489D

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	156	188	N/A	INTRINSIC
low complexity region	263	279	N/A	INTRINSIC
Pfam:RHD	415	575	7.4e-28	PFAM
IPT	582	681	8.99e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000078049
AA Change: V503D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077196
Gene: ENSMUSG00000033016
AA Change: V503D

Domain	Start	End	E-Value	Type
low complexity region	170	202	N/A	INTRINSIC
low complexity region	277	293	N/A	INTRINSIC
Pfam:RHD	429	589	1.3e-27	PFAM
IPT	596	695	8.99e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167977
AA Change: V489D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126884
Gene: ENSMUSG00000033016
AA Change: V489D

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	156	188	N/A	INTRINSIC
low complexity region	263	279	N/A	INTRINSIC
Pfam:RHD	415	575	4.9e-28	PFAM
IPT	582	681	8.99e-21	SMART
low complexity region	832	841	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170905
AA Change: V503D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129001
Gene: ENSMUSG00000033016
AA Change: V503D

Domain	Start	End	E-Value	Type
low complexity region	170	202	N/A	INTRINSIC
low complexity region	277	293	N/A	INTRINSIC
Pfam:RHD_DNA_bind	429	589	5.1e-28	PFAM
IPT	596	695	8.99e-21	SMART
low complexity region	846	855	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality throughout fetal growth and development due to cardiac failure. Mutants exhibit blood circulation, cardiac valve and ventricular septal abnormalities, edema, abdominal hemorrhage, and semilunar valveregurgitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,137,722	S89P	probably benign	Het
Aatf	A	T	11: 84,470,676	M367K	probably benign	Het
Adam18	A	T	8: 24,652,127	I211N	probably damaging	Het
Angpt1	T	C	15: 42,427,034	Y478C	probably damaging	Het
Apba2	A	T	7: 64,736,926	I434F	probably damaging	Het
Arfgef1	T	A	1: 10,216,534	K50N	probably benign	Het
Arfgef2	A	T	2: 166,873,983	Q1397H	probably benign	Het
Ascc2	G	A	11: 4,647,208	R129Q	probably damaging	Het
Atxn1	A	G	13: 45,566,556	V621A	probably benign	Het
Catsperz	A	T	19: 6,922,562	L192M	probably benign	Het
Cd5	G	A	19: 10,720,221	P465S	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cfap61	A	G	2: 145,947,183	E94G	probably benign	Het
Chd1	A	G	17: 15,762,449	H1392R	probably damaging	Het
Csnk1a1	A	G	18: 61,555,817	I23V	probably benign	Het
Ctnnd2	C	T	15: 30,647,033	R292C	probably benign	Het
Dcaf6	T	A	1: 165,388,675	H453L	probably benign	Het
Dnah3	C	A	7: 120,011,030	D1728Y	probably damaging	Het
Dtx3	T	C	10: 127,192,824	K179E	possibly damaging	Het
Fam3b	T	A	16: 97,481,853	Y74F	probably benign	Het
Gm5464	T	C	14: 66,869,106	L64P	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Kcnh7	T	A	2: 62,764,608	H706L	probably damaging	Het
Kdm2b	C	T	5: 122,880,176	R1067H	probably damaging	Het
Klhl28	A	T	12: 64,950,090	H492Q	probably damaging	Het
Loxl3	T	A	6: 83,050,624	C716S	probably damaging	Het
Ltbp2	A	G	12: 84,786,413	Y1474H	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Mmp24	G	T	2: 155,814,015	V458L	probably benign	Het
Mpl	C	A	4: 118,446,109	S502I		Het
Nim1k	A	G	13: 119,714,271	I133T	possibly damaging	Het
Nr1d2	T	C	14: 18,215,031	Y327C	probably damaging	Het
Olfr1214	T	C	2: 88,988,065	T46A	probably benign	Het
Oma1	C	T	4: 103,328,916	R360*	probably null	Het
Oog2	T	A	4: 144,194,173	W59R	probably damaging	Het
Pcdh10	A	G	3: 45,379,539	E96G	probably damaging	Het
Pcna	T	A	2: 132,251,930	T98S	probably benign	Het
Pcnx3	C	T	19: 5,679,590	C899Y	possibly damaging	Het
Phf11d	T	C	14: 59,356,434	N97S	probably benign	Het
Plekhg4	G	A	8: 105,377,329	W431*	probably null	Het
Plk4	A	G	3: 40,813,466	T815A	probably benign	Het
Pnma2	C	T	14: 66,916,313	T62I	possibly damaging	Het
Ppp1r9a	C	T	6: 5,057,568	R548W	probably damaging	Het
Ptx3	A	G	3: 66,224,780	S241G	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rplp0	A	T	5: 115,560,764	K26N	probably damaging	Het
Sec62	A	C	3: 30,818,782	E338A	unknown	Het
Sema6a	T	C	18: 47,248,955	M842V	probably benign	Het
Serpina3j	T	C	12: 104,314,784	V72A	probably benign	Het
Siglecf	T	C	7: 43,351,944	F112S	probably damaging	Het
Slc29a4	A	G	5: 142,720,125	N455D	probably damaging	Het
Slc6a11	T	A	6: 114,131,437	F54Y	probably benign	Het
Spag6	G	A	2: 18,710,583	V80M	probably damaging	Het
Spic	T	C	10: 88,678,636	E34G	possibly damaging	Het
Tecpr2	A	G	12: 110,931,720	K469E	possibly damaging	Het
Them7	T	A	2: 105,297,845	L57Q	probably benign	Het
Tlr3	G	A	8: 45,396,941	A897V	probably damaging	Het
Tnp2	A	G	16: 10,788,508	C32R	possibly damaging	Het
Trpm6	A	T	19: 18,853,968	Q1399L	probably benign	Het
Ttn	C	A	2: 76,846,671	E11074*	probably null	Het
Ubash3b	G	A	9: 41,043,485	A243V	probably benign	Het
Vash1	G	A	12: 86,680,178	R64Q	possibly damaging	Het
Vmn1r167	T	A	7: 23,505,556	M12L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,581	H645L	probably benign	Het
Vmn2r75	A	T	7: 86,148,514	I697K	probably damaging	Het
Vmn2r87	A	G	10: 130,472,257	I704T	probably damaging	Het

Other mutations in Nfatc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Nfatc1	APN	18	80667026	missense	probably damaging	1.00
IGL00742:Nfatc1	APN	18	80698014	missense	probably benign	0.20
IGL01510:Nfatc1	APN	18	80698188	missense	probably damaging	1.00
IGL01790:Nfatc1	APN	18	80667042	missense	probably damaging	1.00
IGL02548:Nfatc1	APN	18	80697898	missense	probably damaging	1.00
goldfeld	UTSW	18	80697832	missense	probably damaging	0.99
Instrumenten	UTSW	18	80682191	missense	probably damaging	0.98
Original	UTSW	18	80653564	splice site	probably null
BB003:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
BB013:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
R0019:Nfatc1	UTSW	18	80635504	missense	probably benign
R0411:Nfatc1	UTSW	18	80698042	missense	possibly damaging	0.88
R0738:Nfatc1	UTSW	18	80697910	missense	probably damaging	1.00
R0940:Nfatc1	UTSW	18	80635895	missense	probably benign	0.03
R1458:Nfatc1	UTSW	18	80665267	splice site	probably benign
R1622:Nfatc1	UTSW	18	80666967	missense	probably damaging	1.00
R1845:Nfatc1	UTSW	18	80635531	missense	possibly damaging	0.67
R2110:Nfatc1	UTSW	18	80635664	nonsense	probably null
R2112:Nfatc1	UTSW	18	80635664	nonsense	probably null
R2157:Nfatc1	UTSW	18	80635845	missense	possibly damaging	0.88
R3857:Nfatc1	UTSW	18	80665275	splice site	probably benign
R3859:Nfatc1	UTSW	18	80665275	splice site	probably benign
R4108:Nfatc1	UTSW	18	80698368	missense	possibly damaging	0.68
R4510:Nfatc1	UTSW	18	80635579	missense	probably damaging	0.96
R4511:Nfatc1	UTSW	18	80635579	missense	probably damaging	0.96
R4618:Nfatc1	UTSW	18	80697832	missense	probably damaging	0.99
R4850:Nfatc1	UTSW	18	80697865	missense	probably benign	0.30
R5329:Nfatc1	UTSW	18	80708117	start codon destroyed	probably null
R5395:Nfatc1	UTSW	18	80636020	missense	possibly damaging	0.80
R5468:Nfatc1	UTSW	18	80649855	missense	probably benign	0.00
R5522:Nfatc1	UTSW	18	80653529	missense	probably benign	0.36
R5568:Nfatc1	UTSW	18	80649822	missense	probably benign	0.12
R6111:Nfatc1	UTSW	18	80697910	missense	probably damaging	1.00
R6190:Nfatc1	UTSW	18	80712670	missense	probably benign	0.21
R6397:Nfatc1	UTSW	18	80635941	missense	probably damaging	1.00
R6943:Nfatc1	UTSW	18	80635555	missense	probably damaging	1.00
R6970:Nfatc1	UTSW	18	80667013	missense	probably benign	0.34
R6994:Nfatc1	UTSW	18	80653564	splice site	probably null
R7679:Nfatc1	UTSW	18	80607990	missense	probably benign
R7703:Nfatc1	UTSW	18	80682289	missense	probably damaging	1.00
R7926:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
R8346:Nfatc1	UTSW	18	80682167	missense	probably benign	0.00
R8480:Nfatc1	UTSW	18	80635644	missense	probably benign	0.15
R8669:Nfatc1	UTSW	18	80682191	missense	probably damaging	0.98
R8928:Nfatc1	UTSW	18	80697965	missense	possibly damaging	0.82
R9194:Nfatc1	UTSW	18	80708043	missense	probably benign	0.04
R9281:Nfatc1	UTSW	18	80697975	missense	probably damaging	1.00
R9517:Nfatc1	UTSW	18	80682191	missense	probably damaging	0.98
R9562:Nfatc1	UTSW	18	80635701	missense	probably damaging	1.00
R9636:Nfatc1	UTSW	18	80663396	missense	possibly damaging	0.50
X0062:Nfatc1	UTSW	18	80697618	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- CCAGAAAGAGGCAAATCTGTCATC -3'
(R):5'- ACAAACAGTTGGTTCCCAGG -3'

Sequencing Primer
(F):5'- AAGTTTCTTCAGGCTCTAGAGAG -3'
(R):5'- AACAGTTGGTTCCCAGGATTTTATG -3'

Posted On

2020-10-20