Mutagenetix > Incidental Mutation

Incidental Mutation 'R8411:Pcnx3'

652711

Institutional Source

Beutler Lab

Gene Symbol

Pcnx3

Ensembl Gene

ENSMUSG00000054874

Gene Name

pecanex homolog 3

Synonyms

Pcnxl3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5664635-5688908 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 5679590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 899 (C899Y)

Ref Sequence

ENSEMBL: ENSMUSP00000109245 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000113615] [ENSMUST00000141577]

AlphaFold

Q8VI59

Predicted Effect

probably benign
Transcript: ENSMUST00000068169
AA Change: C491Y

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874
AA Change: C491Y

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	57	79	N/A	INTRINSIC
low complexity region	99	111	N/A	INTRINSIC
low complexity region	370	376	N/A	INTRINSIC
transmembrane domain	385	407	N/A	INTRINSIC
transmembrane domain	411	428	N/A	INTRINSIC
transmembrane domain	441	463	N/A	INTRINSIC
transmembrane domain	473	492	N/A	INTRINSIC
transmembrane domain	501	523	N/A	INTRINSIC
transmembrane domain	538	560	N/A	INTRINSIC
transmembrane domain	573	592	N/A	INTRINSIC
transmembrane domain	645	667	N/A	INTRINSIC
transmembrane domain	669	691	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC
Pfam:Pecanex_C	1159	1389	7.5e-124	PFAM
low complexity region	1462	1479	N/A	INTRINSIC
low complexity region	1481	1510	N/A	INTRINSIC
low complexity region	1525	1538	N/A	INTRINSIC
low complexity region	1558	1569	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113615
AA Change: C899Y

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: C899Y

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	57	79	N/A	INTRINSIC
low complexity region	99	111	N/A	INTRINSIC
low complexity region	438	459	N/A	INTRINSIC
low complexity region	778	784	N/A	INTRINSIC
transmembrane domain	793	815	N/A	INTRINSIC
transmembrane domain	819	836	N/A	INTRINSIC
transmembrane domain	849	871	N/A	INTRINSIC
transmembrane domain	881	900	N/A	INTRINSIC
transmembrane domain	909	931	N/A	INTRINSIC
transmembrane domain	946	968	N/A	INTRINSIC
transmembrane domain	981	1000	N/A	INTRINSIC
transmembrane domain	1053	1075	N/A	INTRINSIC
transmembrane domain	1077	1099	N/A	INTRINSIC
low complexity region	1419	1433	N/A	INTRINSIC
Pfam:Pecanex_C	1570	1796	5.9e-116	PFAM
low complexity region	1870	1887	N/A	INTRINSIC
low complexity region	1889	1918	N/A	INTRINSIC
low complexity region	1933	1946	N/A	INTRINSIC
low complexity region	1966	1977	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000123696
Gene: ENSMUSG00000054874
AA Change: C189Y

Domain	Start	End	E-Value	Type
low complexity region	69	75	N/A	INTRINSIC
transmembrane domain	84	106	N/A	INTRINSIC
transmembrane domain	110	127	N/A	INTRINSIC
transmembrane domain	140	162	N/A	INTRINSIC
transmembrane domain	172	191	N/A	INTRINSIC
transmembrane domain	200	222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137313

SMART Domains

Protein: ENSMUSP00000115217
Gene: ENSMUSG00000054874

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
transmembrane domain	44	66	N/A	INTRINSIC
transmembrane domain	79	98	N/A	INTRINSIC
transmembrane domain	151	173	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000141577
AA Change: C225Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116451
Gene: ENSMUSG00000054874
AA Change: C225Y

Domain	Start	End	E-Value	Type
low complexity region	104	110	N/A	INTRINSIC
transmembrane domain	119	141	N/A	INTRINSIC
transmembrane domain	145	162	N/A	INTRINSIC
transmembrane domain	175	197	N/A	INTRINSIC
transmembrane domain	207	224	N/A	INTRINSIC
transmembrane domain	229	251	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116493
Gene: ENSMUSG00000054874
AA Change: C319Y

Domain	Start	End	E-Value	Type
low complexity region	199	205	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	240	257	N/A	INTRINSIC
transmembrane domain	270	292	N/A	INTRINSIC
transmembrane domain	302	321	N/A	INTRINSIC
transmembrane domain	330	352	N/A	INTRINSIC
transmembrane domain	367	389	N/A	INTRINSIC
transmembrane domain	402	421	N/A	INTRINSIC
transmembrane domain	474	496	N/A	INTRINSIC
transmembrane domain	498	520	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,137,722	S89P	probably benign	Het
Aatf	A	T	11: 84,470,676	M367K	probably benign	Het
Adam18	A	T	8: 24,652,127	I211N	probably damaging	Het
Angpt1	T	C	15: 42,427,034	Y478C	probably damaging	Het
Apba2	A	T	7: 64,736,926	I434F	probably damaging	Het
Arfgef1	T	A	1: 10,216,534	K50N	probably benign	Het
Arfgef2	A	T	2: 166,873,983	Q1397H	probably benign	Het
Ascc2	G	A	11: 4,647,208	R129Q	probably damaging	Het
Atxn1	A	G	13: 45,566,556	V621A	probably benign	Het
Catsperz	A	T	19: 6,922,562	L192M	probably benign	Het
Cd5	G	A	19: 10,720,221	P465S	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cfap61	A	G	2: 145,947,183	E94G	probably benign	Het
Chd1	A	G	17: 15,762,449	H1392R	probably damaging	Het
Csnk1a1	A	G	18: 61,555,817	I23V	probably benign	Het
Ctnnd2	C	T	15: 30,647,033	R292C	probably benign	Het
Dcaf6	T	A	1: 165,388,675	H453L	probably benign	Het
Dnah3	C	A	7: 120,011,030	D1728Y	probably damaging	Het
Dtx3	T	C	10: 127,192,824	K179E	possibly damaging	Het
Fam3b	T	A	16: 97,481,853	Y74F	probably benign	Het
Gm5464	T	C	14: 66,869,106	L64P	unknown	Het
Gm5624	T	G	14: 44,561,890	N70T		Het
Kcnh7	T	A	2: 62,764,608	H706L	probably damaging	Het
Kdm2b	C	T	5: 122,880,176	R1067H	probably damaging	Het
Klhl28	A	T	12: 64,950,090	H492Q	probably damaging	Het
Loxl3	T	A	6: 83,050,624	C716S	probably damaging	Het
Ltbp2	A	G	12: 84,786,413	Y1474H	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Mmp24	G	T	2: 155,814,015	V458L	probably benign	Het
Mpl	C	A	4: 118,446,109	S502I		Het
Nfatc1	A	T	18: 80,667,042	V503D	probably damaging	Het
Nim1k	A	G	13: 119,714,271	I133T	possibly damaging	Het
Nr1d2	T	C	14: 18,215,031	Y327C	probably damaging	Het
Olfr1214	T	C	2: 88,988,065	T46A	probably benign	Het
Oma1	C	T	4: 103,328,916	R360*	probably null	Het
Oog2	T	A	4: 144,194,173	W59R	probably damaging	Het
Pcdh10	A	G	3: 45,379,539	E96G	probably damaging	Het
Pcna	T	A	2: 132,251,930	T98S	probably benign	Het
Phf11d	T	C	14: 59,356,434	N97S	probably benign	Het
Plekhg4	G	A	8: 105,377,329	W431*	probably null	Het
Plk4	A	G	3: 40,813,466	T815A	probably benign	Het
Pnma2	C	T	14: 66,916,313	T62I	possibly damaging	Het
Ppp1r9a	C	T	6: 5,057,568	R548W	probably damaging	Het
Ptx3	A	G	3: 66,224,780	S241G	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rplp0	A	T	5: 115,560,764	K26N	probably damaging	Het
Sec62	A	C	3: 30,818,782	E338A	unknown	Het
Sema6a	T	C	18: 47,248,955	M842V	probably benign	Het
Serpina3j	T	C	12: 104,314,784	V72A	probably benign	Het
Siglecf	T	C	7: 43,351,944	F112S	probably damaging	Het
Slc29a4	A	G	5: 142,720,125	N455D	probably damaging	Het
Slc6a11	T	A	6: 114,131,437	F54Y	probably benign	Het
Spag6	G	A	2: 18,710,583	V80M	probably damaging	Het
Spic	T	C	10: 88,678,636	E34G	possibly damaging	Het
Tecpr2	A	G	12: 110,931,720	K469E	possibly damaging	Het
Them7	T	A	2: 105,297,845	L57Q	probably benign	Het
Tlr3	G	A	8: 45,396,941	A897V	probably damaging	Het
Tnp2	A	G	16: 10,788,508	C32R	possibly damaging	Het
Trpm6	A	T	19: 18,853,968	Q1399L	probably benign	Het
Ttn	C	A	2: 76,846,671	E11074*	probably null	Het
Ubash3b	G	A	9: 41,043,485	A243V	probably benign	Het
Vash1	G	A	12: 86,680,178	R64Q	possibly damaging	Het
Vmn1r167	T	A	7: 23,505,556	M12L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,581	H645L	probably benign	Het
Vmn2r75	A	T	7: 86,148,514	I697K	probably damaging	Het
Vmn2r87	A	G	10: 130,472,257	I704T	probably damaging	Het

Other mutations in Pcnx3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01616:Pcnx3	APN	19	5667259	unclassified	probably benign
IGL01667:Pcnx3	APN	19	5686630	missense	probably benign	0.03
IGL01704:Pcnx3	APN	19	5667476	missense	probably damaging	1.00
IGL01752:Pcnx3	APN	19	5665337	nonsense	probably null
IGL01791:Pcnx3	APN	19	5673267	missense	probably benign	0.39
IGL01937:Pcnx3	APN	19	5677663	missense	probably benign
IGL01987:Pcnx3	APN	19	5677479	missense	probably damaging	1.00
IGL02073:Pcnx3	APN	19	5679386	missense	probably damaging	0.99
IGL02417:Pcnx3	APN	19	5686481	missense	possibly damaging	0.92
IGL03143:Pcnx3	APN	19	5685395	missense	probably damaging	1.00
buns	UTSW	19	5683340	start codon destroyed	probably null
Pastries	UTSW	19	5683339	nonsense	probably null
pie	UTSW	19	5667158	missense	possibly damaging	0.81
R7096_pcnx3_526	UTSW	19	5672615	missense	probably damaging	1.00
swirls	UTSW	19	5672515	missense	probably damaging	1.00
tip	UTSW	19	5683780	splice site	probably benign
PIT4453001:Pcnx3	UTSW	19	5672756	critical splice donor site	probably null
R0234:Pcnx3	UTSW	19	5672618	missense	probably benign	0.12
R0234:Pcnx3	UTSW	19	5672618	missense	probably benign	0.12
R0360:Pcnx3	UTSW	19	5665583	missense	probably damaging	0.98
R0687:Pcnx3	UTSW	19	5684333	missense	probably damaging	1.00
R0718:Pcnx3	UTSW	19	5677728	splice site	probably benign
R0840:Pcnx3	UTSW	19	5685701	splice site	probably null
R0907:Pcnx3	UTSW	19	5671525	missense	possibly damaging	0.95
R1251:Pcnx3	UTSW	19	5677182	missense	probably benign	0.03
R1373:Pcnx3	UTSW	19	5665516	missense	probably damaging	0.97
R1467:Pcnx3	UTSW	19	5674894	missense	possibly damaging	0.63
R1467:Pcnx3	UTSW	19	5674894	missense	possibly damaging	0.63
R1572:Pcnx3	UTSW	19	5685347	nonsense	probably null
R1602:Pcnx3	UTSW	19	5672515	missense	probably damaging	1.00
R1628:Pcnx3	UTSW	19	5686065	missense	probably damaging	0.99
R1635:Pcnx3	UTSW	19	5665745	missense	probably benign	0.00
R1670:Pcnx3	UTSW	19	5673315	missense	probably damaging	1.00
R1889:Pcnx3	UTSW	19	5672656	missense	probably damaging	1.00
R1898:Pcnx3	UTSW	19	5672587	missense	probably damaging	1.00
R2113:Pcnx3	UTSW	19	5671556	missense	possibly damaging	0.93
R2147:Pcnx3	UTSW	19	5667605	missense	probably damaging	1.00
R2358:Pcnx3	UTSW	19	5683339	nonsense	probably null
R2358:Pcnx3	UTSW	19	5683340	start codon destroyed	probably null
R2871:Pcnx3	UTSW	19	5683746	intron	probably benign
R3699:Pcnx3	UTSW	19	5672465	missense	probably damaging	1.00
R3712:Pcnx3	UTSW	19	5683339	nonsense	probably null
R3712:Pcnx3	UTSW	19	5683340	start codon destroyed	probably null
R3798:Pcnx3	UTSW	19	5678668	nonsense	probably null
R3856:Pcnx3	UTSW	19	5678967	missense	probably benign	0.02
R3953:Pcnx3	UTSW	19	5683780	splice site	probably benign
R4613:Pcnx3	UTSW	19	5667219	missense	possibly damaging	0.51
R4781:Pcnx3	UTSW	19	5687130	missense	probably damaging	0.99
R4816:Pcnx3	UTSW	19	5687995	critical splice donor site	probably null
R5338:Pcnx3	UTSW	19	5672596	missense	probably damaging	1.00
R5770:Pcnx3	UTSW	19	5681579	intron	probably benign
R5950:Pcnx3	UTSW	19	5667158	missense	possibly damaging	0.81
R5951:Pcnx3	UTSW	19	5671680	missense	possibly damaging	0.71
R5969:Pcnx3	UTSW	19	5685535	missense	probably damaging	1.00
R6543:Pcnx3	UTSW	19	5665247	missense	probably benign	0.07
R6704:Pcnx3	UTSW	19	5686487	missense	possibly damaging	0.74
R7096:Pcnx3	UTSW	19	5672615	missense	probably damaging	1.00
R7177:Pcnx3	UTSW	19	5687499	missense	probably benign	0.01
R7308:Pcnx3	UTSW	19	5686147	missense	possibly damaging	0.52
R7387:Pcnx3	UTSW	19	5673336	missense	probably benign	0.33
R7488:Pcnx3	UTSW	19	5667459	missense	possibly damaging	0.72
R7670:Pcnx3	UTSW	19	5677182	missense	probably benign	0.03
R7831:Pcnx3	UTSW	19	5685961	missense	probably damaging	0.96
R7850:Pcnx3	UTSW	19	5678932	missense	possibly damaging	0.55
R8120:Pcnx3	UTSW	19	5667546	missense	probably benign
R8139:Pcnx3	UTSW	19	5665745	missense	probably benign	0.00
R8258:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8259:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8260:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8261:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8262:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8350:Pcnx3	UTSW	19	5673226	missense	probably damaging	1.00
R8429:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8431:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8443:Pcnx3	UTSW	19	5686642	missense	probably benign
R8450:Pcnx3	UTSW	19	5673226	missense	probably damaging	1.00
R8494:Pcnx3	UTSW	19	5675376	missense	probably damaging	0.99
R8790:Pcnx3	UTSW	19	5685178	missense	possibly damaging	0.71
R8939:Pcnx3	UTSW	19	5680319	missense	probably damaging	0.98
R9065:Pcnx3	UTSW	19	5667554	missense	possibly damaging	0.86
R9070:Pcnx3	UTSW	19	5665573	missense	probably benign	0.33
X0028:Pcnx3	UTSW	19	5684427	missense	probably damaging	1.00
X0053:Pcnx3	UTSW	19	5686622	splice site	probably null
Z1176:Pcnx3	UTSW	19	5687220	critical splice acceptor site	probably null
Z1177:Pcnx3	UTSW	19	5671626	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AGCCATGCATGTCTATCTGC -3'
(R):5'- AAGGCCCAATTCCTCACTGG -3'

Sequencing Primer
(F):5'- CTATCTGCTCCAGGAGGTACATGAG -3'
(R):5'- ACTGGCCCACTTCCTAGG -3'

Posted On

2020-10-20