Incidental Mutation 'R8411:Pcnx3'
ID 652711
Institutional Source Beutler Lab
Gene Symbol Pcnx3
Ensembl Gene ENSMUSG00000054874
Gene Name pecanex homolog 3
Synonyms Pcnxl3
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 5714663-5738936 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 5729618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 899 (C899Y)
Ref Sequence ENSEMBL: ENSMUSP00000109245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000113615] [ENSMUST00000141577]
AlphaFold Q8VI59
Predicted Effect probably benign
Transcript: ENSMUST00000068169
AA Change: C491Y

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874
AA Change: C491Y

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113615
AA Change: C899Y

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: C899Y

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123696
Gene: ENSMUSG00000054874
AA Change: C189Y

DomainStartEndE-ValueType
low complexity region 69 75 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 110 127 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 172 191 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137313
SMART Domains Protein: ENSMUSP00000115217
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 79 98 N/A INTRINSIC
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141577
AA Change: C225Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116451
Gene: ENSMUSG00000054874
AA Change: C225Y

DomainStartEndE-ValueType
low complexity region 104 110 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
transmembrane domain 207 224 N/A INTRINSIC
transmembrane domain 229 251 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000116493
Gene: ENSMUSG00000054874
AA Change: C319Y

DomainStartEndE-ValueType
low complexity region 199 205 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 240 257 N/A INTRINSIC
transmembrane domain 270 292 N/A INTRINSIC
transmembrane domain 302 321 N/A INTRINSIC
transmembrane domain 330 352 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 402 421 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
transmembrane domain 498 520 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Trpm6 A T 19: 18,831,332 (GRCm39) Q1399L probably benign Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Pcnx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Pcnx3 APN 19 5,717,287 (GRCm39) unclassified probably benign
IGL01667:Pcnx3 APN 19 5,736,658 (GRCm39) missense probably benign 0.03
IGL01704:Pcnx3 APN 19 5,717,504 (GRCm39) missense probably damaging 1.00
IGL01752:Pcnx3 APN 19 5,715,365 (GRCm39) nonsense probably null
IGL01791:Pcnx3 APN 19 5,723,295 (GRCm39) missense probably benign 0.39
IGL01937:Pcnx3 APN 19 5,727,691 (GRCm39) missense probably benign
IGL01987:Pcnx3 APN 19 5,727,507 (GRCm39) missense probably damaging 1.00
IGL02073:Pcnx3 APN 19 5,729,414 (GRCm39) missense probably damaging 0.99
IGL02417:Pcnx3 APN 19 5,736,509 (GRCm39) missense possibly damaging 0.92
IGL03143:Pcnx3 APN 19 5,735,423 (GRCm39) missense probably damaging 1.00
buns UTSW 19 5,733,368 (GRCm39) start codon destroyed probably null
Pastries UTSW 19 5,733,367 (GRCm39) nonsense probably null
pie UTSW 19 5,717,186 (GRCm39) missense possibly damaging 0.81
R7096_pcnx3_526 UTSW 19 5,722,643 (GRCm39) missense probably damaging 1.00
swirls UTSW 19 5,722,543 (GRCm39) missense probably damaging 1.00
tip UTSW 19 5,733,808 (GRCm39) splice site probably benign
PIT4453001:Pcnx3 UTSW 19 5,722,784 (GRCm39) critical splice donor site probably null
R0234:Pcnx3 UTSW 19 5,722,646 (GRCm39) missense probably benign 0.12
R0234:Pcnx3 UTSW 19 5,722,646 (GRCm39) missense probably benign 0.12
R0360:Pcnx3 UTSW 19 5,715,611 (GRCm39) missense probably damaging 0.98
R0687:Pcnx3 UTSW 19 5,734,361 (GRCm39) missense probably damaging 1.00
R0718:Pcnx3 UTSW 19 5,727,756 (GRCm39) splice site probably benign
R0840:Pcnx3 UTSW 19 5,735,729 (GRCm39) splice site probably null
R0907:Pcnx3 UTSW 19 5,721,553 (GRCm39) missense possibly damaging 0.95
R1251:Pcnx3 UTSW 19 5,727,210 (GRCm39) missense probably benign 0.03
R1373:Pcnx3 UTSW 19 5,715,544 (GRCm39) missense probably damaging 0.97
R1467:Pcnx3 UTSW 19 5,724,922 (GRCm39) missense possibly damaging 0.63
R1467:Pcnx3 UTSW 19 5,724,922 (GRCm39) missense possibly damaging 0.63
R1572:Pcnx3 UTSW 19 5,735,375 (GRCm39) nonsense probably null
R1602:Pcnx3 UTSW 19 5,722,543 (GRCm39) missense probably damaging 1.00
R1628:Pcnx3 UTSW 19 5,736,093 (GRCm39) missense probably damaging 0.99
R1635:Pcnx3 UTSW 19 5,715,773 (GRCm39) missense probably benign 0.00
R1670:Pcnx3 UTSW 19 5,723,343 (GRCm39) missense probably damaging 1.00
R1889:Pcnx3 UTSW 19 5,722,684 (GRCm39) missense probably damaging 1.00
R1898:Pcnx3 UTSW 19 5,722,615 (GRCm39) missense probably damaging 1.00
R2113:Pcnx3 UTSW 19 5,721,584 (GRCm39) missense possibly damaging 0.93
R2147:Pcnx3 UTSW 19 5,717,633 (GRCm39) missense probably damaging 1.00
R2358:Pcnx3 UTSW 19 5,733,368 (GRCm39) start codon destroyed probably null
R2358:Pcnx3 UTSW 19 5,733,367 (GRCm39) nonsense probably null
R2871:Pcnx3 UTSW 19 5,733,774 (GRCm39) intron probably benign
R3699:Pcnx3 UTSW 19 5,722,493 (GRCm39) missense probably damaging 1.00
R3712:Pcnx3 UTSW 19 5,733,368 (GRCm39) start codon destroyed probably null
R3712:Pcnx3 UTSW 19 5,733,367 (GRCm39) nonsense probably null
R3798:Pcnx3 UTSW 19 5,728,696 (GRCm39) nonsense probably null
R3856:Pcnx3 UTSW 19 5,728,995 (GRCm39) missense probably benign 0.02
R3953:Pcnx3 UTSW 19 5,733,808 (GRCm39) splice site probably benign
R4613:Pcnx3 UTSW 19 5,717,247 (GRCm39) missense possibly damaging 0.51
R4781:Pcnx3 UTSW 19 5,737,158 (GRCm39) missense probably damaging 0.99
R4816:Pcnx3 UTSW 19 5,738,023 (GRCm39) critical splice donor site probably null
R5338:Pcnx3 UTSW 19 5,722,624 (GRCm39) missense probably damaging 1.00
R5770:Pcnx3 UTSW 19 5,731,607 (GRCm39) intron probably benign
R5950:Pcnx3 UTSW 19 5,717,186 (GRCm39) missense possibly damaging 0.81
R5951:Pcnx3 UTSW 19 5,721,708 (GRCm39) missense possibly damaging 0.71
R5969:Pcnx3 UTSW 19 5,735,563 (GRCm39) missense probably damaging 1.00
R6543:Pcnx3 UTSW 19 5,715,275 (GRCm39) missense probably benign 0.07
R6704:Pcnx3 UTSW 19 5,736,515 (GRCm39) missense possibly damaging 0.74
R7096:Pcnx3 UTSW 19 5,722,643 (GRCm39) missense probably damaging 1.00
R7177:Pcnx3 UTSW 19 5,737,527 (GRCm39) missense probably benign 0.01
R7308:Pcnx3 UTSW 19 5,736,175 (GRCm39) missense possibly damaging 0.52
R7387:Pcnx3 UTSW 19 5,723,364 (GRCm39) missense probably benign 0.33
R7488:Pcnx3 UTSW 19 5,717,487 (GRCm39) missense possibly damaging 0.72
R7670:Pcnx3 UTSW 19 5,727,210 (GRCm39) missense probably benign 0.03
R7831:Pcnx3 UTSW 19 5,735,989 (GRCm39) missense probably damaging 0.96
R7850:Pcnx3 UTSW 19 5,728,960 (GRCm39) missense possibly damaging 0.55
R8120:Pcnx3 UTSW 19 5,717,574 (GRCm39) missense probably benign
R8139:Pcnx3 UTSW 19 5,715,773 (GRCm39) missense probably benign 0.00
R8258:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8259:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8260:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8261:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8262:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8350:Pcnx3 UTSW 19 5,723,254 (GRCm39) missense probably damaging 1.00
R8429:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8431:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8443:Pcnx3 UTSW 19 5,736,670 (GRCm39) missense probably benign
R8450:Pcnx3 UTSW 19 5,723,254 (GRCm39) missense probably damaging 1.00
R8494:Pcnx3 UTSW 19 5,725,404 (GRCm39) missense probably damaging 0.99
R8790:Pcnx3 UTSW 19 5,735,206 (GRCm39) missense possibly damaging 0.71
R8939:Pcnx3 UTSW 19 5,730,347 (GRCm39) missense probably damaging 0.98
R9065:Pcnx3 UTSW 19 5,717,582 (GRCm39) missense possibly damaging 0.86
R9070:Pcnx3 UTSW 19 5,715,601 (GRCm39) missense probably benign 0.33
X0028:Pcnx3 UTSW 19 5,734,455 (GRCm39) missense probably damaging 1.00
X0053:Pcnx3 UTSW 19 5,736,650 (GRCm39) splice site probably null
Z1176:Pcnx3 UTSW 19 5,737,248 (GRCm39) critical splice acceptor site probably null
Z1177:Pcnx3 UTSW 19 5,721,654 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGCCATGCATGTCTATCTGC -3'
(R):5'- AAGGCCCAATTCCTCACTGG -3'

Sequencing Primer
(F):5'- CTATCTGCTCCAGGAGGTACATGAG -3'
(R):5'- ACTGGCCCACTTCCTAGG -3'
Posted On 2020-10-20