Incidental Mutation 'R8411:Trpm6'
ID 652714
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 067881-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 18727347-18869875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18831332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1399 (Q1399L)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: Q1399L

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: Q1399L

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,285,588 (GRCm39) S89P probably benign Het
Aatf A T 11: 84,361,502 (GRCm39) M367K probably benign Het
Adam18 A T 8: 25,142,143 (GRCm39) I211N probably damaging Het
Angpt1 T C 15: 42,290,430 (GRCm39) Y478C probably damaging Het
Apba2 A T 7: 64,386,674 (GRCm39) I434F probably damaging Het
Arfgef1 T A 1: 10,286,759 (GRCm39) K50N probably benign Het
Arfgef2 A T 2: 166,715,903 (GRCm39) Q1397H probably benign Het
Ascc2 G A 11: 4,597,208 (GRCm39) R129Q probably damaging Het
Atxn1 A G 13: 45,720,032 (GRCm39) V621A probably benign Het
Catsperz A T 19: 6,899,930 (GRCm39) L192M probably benign Het
Cd5 G A 19: 10,697,585 (GRCm39) P465S probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cfap61 A G 2: 145,789,103 (GRCm39) E94G probably benign Het
Chd1 A G 17: 15,982,711 (GRCm39) H1392R probably damaging Het
Csnk1a1 A G 18: 61,688,888 (GRCm39) I23V probably benign Het
Ctnnd2 C T 15: 30,647,179 (GRCm39) R292C probably benign Het
Dcaf6 T A 1: 165,216,244 (GRCm39) H453L probably benign Het
Dnah3 C A 7: 119,610,253 (GRCm39) D1728Y probably damaging Het
Dtx3 T C 10: 127,028,693 (GRCm39) K179E possibly damaging Het
Fam3b T A 16: 97,283,053 (GRCm39) Y74F probably benign Het
Gm5464 T C 14: 67,106,555 (GRCm39) L64P unknown Het
Gm5624 T G 14: 44,799,347 (GRCm39) N70T Het
Kcnh7 T A 2: 62,594,952 (GRCm39) H706L probably damaging Het
Kdm2b C T 5: 123,018,239 (GRCm39) R1067H probably damaging Het
Klhl28 A T 12: 64,996,864 (GRCm39) H492Q probably damaging Het
Loxl3 T A 6: 83,027,605 (GRCm39) C716S probably damaging Het
Ltbp2 A G 12: 84,833,187 (GRCm39) Y1474H probably damaging Het
Mcm3 C T 1: 20,886,980 (GRCm39) V142I probably benign Het
Mmp24 G T 2: 155,655,935 (GRCm39) V458L probably benign Het
Mpl C A 4: 118,303,306 (GRCm39) S502I Het
Nfatc1 A T 18: 80,710,257 (GRCm39) V503D probably damaging Het
Nim1k A G 13: 120,175,807 (GRCm39) I133T possibly damaging Het
Nr1d2 T C 14: 18,215,031 (GRCm38) Y327C probably damaging Het
Oma1 C T 4: 103,186,113 (GRCm39) R360* probably null Het
Oog2 T A 4: 143,920,743 (GRCm39) W59R probably damaging Het
Or4c109 T C 2: 88,818,409 (GRCm39) T46A probably benign Het
Pcdh10 A G 3: 45,333,974 (GRCm39) E96G probably damaging Het
Pcna T A 2: 132,093,850 (GRCm39) T98S probably benign Het
Pcnx3 C T 19: 5,729,618 (GRCm39) C899Y possibly damaging Het
Phf11d T C 14: 59,593,883 (GRCm39) N97S probably benign Het
Plekhg4 G A 8: 106,103,961 (GRCm39) W431* probably null Het
Plk4 A G 3: 40,767,901 (GRCm39) T815A probably benign Het
Pnma2 C T 14: 67,153,762 (GRCm39) T62I possibly damaging Het
Ppp1r9a C T 6: 5,057,568 (GRCm39) R548W probably damaging Het
Ptx3 A G 3: 66,132,201 (GRCm39) S241G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rplp0 A T 5: 115,698,823 (GRCm39) K26N probably damaging Het
Sec62 A C 3: 30,872,931 (GRCm39) E338A unknown Het
Sema6a T C 18: 47,382,022 (GRCm39) M842V probably benign Het
Serpina3j T C 12: 104,281,043 (GRCm39) V72A probably benign Het
Siglecf T C 7: 43,001,368 (GRCm39) F112S probably damaging Het
Slc29a4 A G 5: 142,705,880 (GRCm39) N455D probably damaging Het
Slc6a11 T A 6: 114,108,398 (GRCm39) F54Y probably benign Het
Spag6 G A 2: 18,715,394 (GRCm39) V80M probably damaging Het
Spic T C 10: 88,514,498 (GRCm39) E34G possibly damaging Het
Tecpr2 A G 12: 110,898,154 (GRCm39) K469E possibly damaging Het
Them7 T A 2: 105,128,190 (GRCm39) L57Q probably benign Het
Tlr3 G A 8: 45,849,978 (GRCm39) A897V probably damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Ttn C A 2: 76,677,015 (GRCm39) E11074* probably null Het
Ubash3b G A 9: 40,954,781 (GRCm39) A243V probably benign Het
Vash1 G A 12: 86,726,952 (GRCm39) R64Q possibly damaging Het
Vmn1r167 T A 7: 23,204,981 (GRCm39) M12L possibly damaging Het
Vmn2r111 T A 17: 22,767,562 (GRCm39) H645L probably benign Het
Vmn2r75 A T 7: 85,797,722 (GRCm39) I697K probably damaging Het
Vmn2r87 A G 10: 130,308,126 (GRCm39) I704T probably damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,761,272 (GRCm39) splice site probably benign
IGL00862:Trpm6 APN 19 18,804,892 (GRCm39) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,855,015 (GRCm39) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,803,158 (GRCm39) nonsense probably null
IGL01451:Trpm6 APN 19 18,786,933 (GRCm39) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,773,894 (GRCm39) nonsense probably null
IGL01995:Trpm6 APN 19 18,807,691 (GRCm39) splice site probably benign
IGL02092:Trpm6 APN 19 18,749,695 (GRCm39) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,809,903 (GRCm39) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,831,427 (GRCm39) missense probably benign
IGL02329:Trpm6 APN 19 18,831,581 (GRCm39) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,755,874 (GRCm39) splice site probably benign
IGL02402:Trpm6 APN 19 18,764,120 (GRCm39) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,804,762 (GRCm39) nonsense probably null
IGL02457:Trpm6 APN 19 18,803,155 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,779,571 (GRCm39) splice site probably benign
IGL02705:Trpm6 APN 19 18,754,097 (GRCm39) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,787,016 (GRCm39) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,807,376 (GRCm39) splice site probably benign
IGL02818:Trpm6 APN 19 18,843,621 (GRCm39) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,790,846 (GRCm39) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,815,381 (GRCm39) nonsense probably null
IGL03193:Trpm6 APN 19 18,803,236 (GRCm39) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,764,143 (GRCm39) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,796,483 (GRCm39) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,796,545 (GRCm39) missense probably benign
IGL03245:Trpm6 APN 19 18,855,065 (GRCm39) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,815,446 (GRCm39) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,790,850 (GRCm39) missense probably benign
P0043:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,803,166 (GRCm39) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,764,119 (GRCm39) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,809,957 (GRCm39) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,796,558 (GRCm39) splice site probably null
R0267:Trpm6 UTSW 19 18,800,742 (GRCm39) missense probably benign
R0350:Trpm6 UTSW 19 18,861,321 (GRCm39) splice site probably null
R0373:Trpm6 UTSW 19 18,830,951 (GRCm39) missense probably benign 0.15
R0393:Trpm6 UTSW 19 18,756,008 (GRCm39) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,760,389 (GRCm39) splice site probably benign
R0505:Trpm6 UTSW 19 18,851,266 (GRCm39) splice site probably benign
R0526:Trpm6 UTSW 19 18,770,240 (GRCm39) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,849,585 (GRCm39) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,803,226 (GRCm39) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,815,451 (GRCm39) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,773,862 (GRCm39) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,773,859 (GRCm39) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,853,295 (GRCm39) missense probably benign
R1558:Trpm6 UTSW 19 18,764,192 (GRCm39) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,804,888 (GRCm39) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,854,995 (GRCm39) missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18,833,581 (GRCm39) missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18,804,931 (GRCm39) missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18,869,363 (GRCm39) splice site probably null
R1840:Trpm6 UTSW 19 18,843,631 (GRCm39) missense probably benign 0.21
R1991:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,831,629 (GRCm39) missense probably benign
R2073:Trpm6 UTSW 19 18,853,406 (GRCm39) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,855,103 (GRCm39) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,803,116 (GRCm39) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,790,714 (GRCm39) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,769,454 (GRCm39) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,831,795 (GRCm39) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,749,757 (GRCm39) nonsense probably null
R3779:Trpm6 UTSW 19 18,853,403 (GRCm39) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,809,921 (GRCm39) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,804,889 (GRCm39) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,773,864 (GRCm39) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,809,841 (GRCm39) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,809,961 (GRCm39) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,803,236 (GRCm39) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,831,564 (GRCm39) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,853,428 (GRCm39) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,790,857 (GRCm39) missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18,845,345 (GRCm39) missense probably benign 0.00
R4814:Trpm6 UTSW 19 18,839,576 (GRCm39) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,764,124 (GRCm39) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,790,828 (GRCm39) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,807,297 (GRCm39) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,807,571 (GRCm39) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,830,968 (GRCm39) missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18,830,981 (GRCm39) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,764,183 (GRCm39) missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18,833,539 (GRCm39) missense probably benign 0.04
R5955:Trpm6 UTSW 19 18,869,383 (GRCm39) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6105:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6211:Trpm6 UTSW 19 18,760,492 (GRCm39) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,831,655 (GRCm39) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,831,472 (GRCm39) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,807,354 (GRCm39) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,815,406 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,866,384 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,773,803 (GRCm39) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,807,661 (GRCm39) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,760,527 (GRCm39) missense probably benign
R7103:Trpm6 UTSW 19 18,790,911 (GRCm39) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,831,397 (GRCm39) nonsense probably null
R7128:Trpm6 UTSW 19 18,789,137 (GRCm39) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,854,150 (GRCm39) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,755,949 (GRCm39) missense probably benign 0.13
R7305:Trpm6 UTSW 19 18,853,455 (GRCm39) missense probably benign 0.30
R7498:Trpm6 UTSW 19 18,853,484 (GRCm39) missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18,756,029 (GRCm39) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,809,945 (GRCm39) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,845,325 (GRCm39) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,853,377 (GRCm39) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,831,613 (GRCm39) missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18,804,772 (GRCm39) missense probably benign 0.03
R7747:Trpm6 UTSW 19 18,727,409 (GRCm39) splice site probably null
R7807:Trpm6 UTSW 19 18,807,220 (GRCm39) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,792,605 (GRCm39) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,754,074 (GRCm39) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,831,654 (GRCm39) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,853,474 (GRCm39) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,756,023 (GRCm39) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,792,714 (GRCm39) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,770,226 (GRCm39) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,789,154 (GRCm39) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,851,225 (GRCm39) missense possibly damaging 0.85
R8413:Trpm6 UTSW 19 18,809,849 (GRCm39) missense probably benign 0.00
R8534:Trpm6 UTSW 19 18,869,459 (GRCm39) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,815,366 (GRCm39) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,792,799 (GRCm39) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,810,016 (GRCm39) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,761,264 (GRCm39) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,755,978 (GRCm39) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,764,123 (GRCm39) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,853,394 (GRCm39) nonsense probably null
R9564:Trpm6 UTSW 19 18,851,240 (GRCm39) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,790,846 (GRCm39) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,869,466 (GRCm39) missense probably benign
R9721:Trpm6 UTSW 19 18,807,336 (GRCm39) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,800,766 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCCTCACATGTAAGAGAAGAGC -3'
(R):5'- ATGCTGATGGCTCTCGAAGG -3'

Sequencing Primer
(F):5'- GGATTTCCCATGTCAGACAAGC -3'
(R):5'- CTCTCGAAGGAAGAGAAGTCACTGTC -3'
Posted On 2020-10-20