Incidental Mutation 'R8412:Slc19a3'
ID652716
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Namesolute carrier family 19, member 3
SynonymsThTr2, A230084E24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location83012523-83038448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83014812 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 396 (R396H)
Ref Sequence ENSEMBL: ENSMUSP00000041683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
Predicted Effect probably damaging
Transcript: ENSMUST00000045560
AA Change: R396H

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: R396H

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164473
AA Change: R396H

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: R396H

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 83014836 missense probably damaging 0.99
tag UTSW 1 83026260 missense probably damaging 1.00
R0437:Slc19a3 UTSW 1 83022565 missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83022733 missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83022692 missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83022762 missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83022747 missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 83019368 missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83022798 missense probably benign 0.00
R2058:Slc19a3 UTSW 1 83014791 missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83022943 missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 83013970 missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R2404:Slc19a3 UTSW 1 83023035 missense probably benign 0.16
R3891:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 83014813 missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83022703 missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83022799 missense probably benign
R4768:Slc19a3 UTSW 1 83023113 missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 83019341 missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83022620 missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83022561 missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83023055 nonsense probably null
R6143:Slc19a3 UTSW 1 83026339 missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83026360 missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83022900 missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83022369 missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 83013928 missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83026260 missense probably damaging 1.00
R7584:Slc19a3 UTSW 1 83022748 missense possibly damaging 0.79
R7810:Slc19a3 UTSW 1 83019441 missense probably benign 0.02
R8150:Slc19a3 UTSW 1 83022495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGCCATGTTGGAGGCAAC -3'
(R):5'- GGACATGCCTTAACAACACTG -3'

Sequencing Primer
(F):5'- GAGGCAACCTGGTTATTCTATATTCC -3'
(R):5'- GCTAGGAATGGTCTTGAATCCCTC -3'
Posted On2020-10-20