Incidental Mutation 'R8412:1700056E22Rik'
ID652717
Institutional Source Beutler Lab
Gene Symbol 1700056E22Rik
Ensembl Gene ENSMUSG00000044854
Gene NameRIKEN cDNA 1700056E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location184033030-184034301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 184033159 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 234 (R234S)
Ref Sequence ENSEMBL: ENSMUSP00000055787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048655] [ENSMUST00000050306] [ENSMUST00000139839]
Predicted Effect probably benign
Transcript: ENSMUST00000048655
SMART Domains Protein: ENSMUSP00000045838
Gene: ENSMUSG00000039384

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
RHOD 159 283 1.71e-11 SMART
DSPc 322 462 1.43e-54 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000050306
AA Change: R234S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055787
Gene: ENSMUSG00000044854
AA Change: R234S

DomainStartEndE-ValueType
SCOP:d1howa_ 12 46 7e-3 SMART
low complexity region 81 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139839
SMART Domains Protein: ENSMUSP00000121433
Gene: ENSMUSG00000039384

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in 1700056E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0630:1700056E22Rik UTSW 1 184033907 intron probably benign
R0830:1700056E22Rik UTSW 1 184033427 missense probably damaging 0.99
R0973:1700056E22Rik UTSW 1 184033505 missense probably benign
R0976:1700056E22Rik UTSW 1 184033505 missense probably benign
R1013:1700056E22Rik UTSW 1 184033505 missense probably benign
R1103:1700056E22Rik UTSW 1 184033505 missense probably benign
R1104:1700056E22Rik UTSW 1 184033505 missense probably benign
R1241:1700056E22Rik UTSW 1 184033505 missense probably benign
R1804:1700056E22Rik UTSW 1 184033203 missense probably benign 0.02
R1920:1700056E22Rik UTSW 1 184033631 missense probably benign 0.19
R4705:1700056E22Rik UTSW 1 184033172 missense possibly damaging 0.90
R5135:1700056E22Rik UTSW 1 184033506 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTCTGGGGCCTAAAGCAAAC -3'
(R):5'- TTGAACAGCCAGAATGAGCG -3'

Sequencing Primer
(F):5'- GGGCCTAAAGCAAACGCCTC -3'
(R):5'- CAGAATGAGCGGCGCTTG -3'
Posted On2020-10-20