Mutagenetix > Incidental Mutations

Incidental Mutation 'R8412:Usp8'

652722

Institutional Source

Beutler Lab

Gene Symbol

Usp8

Ensembl Gene

ENSMUSG00000027363

Gene Name

ubiquitin specific peptidase 8

Synonyms

Ubpy

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8412 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126707328-126759297 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 126742658 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 596 (S596P)

Ref Sequence

ENSEMBL: ENSMUSP00000106046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028841] [ENSMUST00000110416] [ENSMUST00000136319]

Predicted Effect

probably benign
Transcript: ENSMUST00000028841
AA Change: S585P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000028841
Gene: ENSMUSG00000027363
AA Change: S585P

Domain	Start	End	E-Value	Type
Pfam:USP8_dimer	6	116	2.3e-37	PFAM
low complexity region	119	140	N/A	INTRINSIC
RHOD	185	310	3.69e-7	SMART
low complexity region	378	393	N/A	INTRINSIC
coiled coil region	467	501	N/A	INTRINSIC
low complexity region	642	657	N/A	INTRINSIC
Pfam:UCH	738	1068	4e-88	PFAM
Pfam:UCH_1	739	1053	1.9e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110416
AA Change: S596P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106046
Gene: ENSMUSG00000027363
AA Change: S596P

Domain	Start	End	E-Value	Type
Pfam:USP8_dimer	6	127	2.5e-36	PFAM
low complexity region	130	151	N/A	INTRINSIC
RHOD	196	321	3.69e-7	SMART
low complexity region	389	404	N/A	INTRINSIC
coiled coil region	478	512	N/A	INTRINSIC
low complexity region	653	668	N/A	INTRINSIC
Pfam:UCH	749	1079	1.3e-82	PFAM
Pfam:UCH_1	750	1064	3.7e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136319

SMART Domains

Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

Domain	Start	End	E-Value	Type
Pfam:UCH	1	268	1.9e-39	PFAM
Pfam:UCH_1	1	269	1.3e-14	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the ubiquitin-specific processing protease family of proteins. The encoded protein is thought to regulate the morphology of the endosome by ubiquitination of proteins on this organelle and is involved in cargo sorting and membrane trafficking at the early endosome stage. This protein is required for the cell to enter the S phase of the cell cycle and also functions as a positive regulator in the Hedgehog signaling pathway in development. Pseudogenes of this gene are present on chromosomes 2 and 6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele appear severely growth retarded and disorganized at E9.5 and die in utero due to ventral-folding defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	T	A	1: 184,033,159	R234S	probably damaging	Het
Ace	T	A	11: 105,979,266	F806Y	probably benign	Het
Ak8	A	G	2: 28,739,631	T286A	probably benign	Het
Apba2	T	A	7: 64,745,798	F674Y	probably damaging	Het
Apob	A	G	12: 8,008,069	I2184V	probably benign	Het
Arhgap23	C	T	11: 97,466,028	P884L	probably benign	Het
Atg2a	T	C	19: 6,244,524	L90P	probably damaging	Het
Bhmt2	T	A	13: 93,662,312	I334F	possibly damaging	Het
Bmi1	C	T	2: 18,684,303	T266I	probably damaging	Het
Cdh26	A	G	2: 178,462,724	I301V	probably damaging	Het
Cenpx	A	T	11: 120,711,732	H68Q	unknown	Het
Cnot10	T	C	9: 114,610,670	R524G	probably benign	Het
Cnpy1	A	T	5: 28,209,208	Y22*	probably null	Het
Csmd3	C	T	15: 47,636,398	R2114H		Het
Defa29	T	A	8: 21,326,046	T102S	probably benign	Het
Fras1	T	C	5: 96,596,852	I582T	probably benign	Het
Gm14295	G	A	2: 176,809,629	C304Y	probably damaging	Het
Gucy2d	T	C	7: 98,443,839	V141A	possibly damaging	Het
Ifi47	A	C	11: 49,095,598	Q64P	probably damaging	Het
Irx3	G	T	8: 91,800,400	S225R	possibly damaging	Het
Itpr1	A	G	6: 108,363,620	H289R	probably benign	Het
Lamc3	A	G	2: 31,912,116	D512G	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Med23	C	A	10: 24,908,734	F1200L	probably benign	Het
Ndst4	A	T	3: 125,570,790	D372V	possibly damaging	Het
Nob1	T	A	8: 107,421,598	K71*	probably null	Het
Ntrk3	A	G	7: 78,356,149	I488T	probably benign	Het
Pds5b	G	T	5: 150,719,959	C82F	probably damaging	Het
Pkd1l3	T	A	8: 109,633,390	V969E	possibly damaging	Het
Ppme1	A	T	7: 100,335,091	N307K	probably benign	Het
Pus7l	C	T	15: 94,527,975	C515Y	probably benign	Het
Rpp21	T	A	17: 36,257,699	H22L	possibly damaging	Het
Scamp3	T	C	3: 89,181,218	F244L	probably damaging	Het
Scgb1b7	A	T	7: 31,712,954	K52*	probably null	Het
Slc12a3	T	C	8: 94,334,067	I261T	probably damaging	Het
Slc19a3	C	T	1: 83,014,812	R396H	probably damaging	Het
Slc22a14	T	C	9: 119,180,856	I58V	probably benign	Het
Slc9a9	A	C	9: 95,229,039	T637P	probably damaging	Het
Snrnp40	T	A	4: 130,384,523	C274S	possibly damaging	Het
Sptbn1	A	G	11: 30,138,457	V905A	probably damaging	Het
Taok3	A	G	5: 117,266,037	D759G	possibly damaging	Het
Tas1r1	T	C	4: 152,032,576	I200M	probably benign	Het
Tnfrsf25	T	C	4: 152,119,682	V360A	possibly damaging	Het
Trim12a	A	T	7: 104,304,337	M189K	possibly damaging	Het
Tspan32	T	C	7: 143,005,958	F41L	probably benign	Het
Tube1	T	A	10: 39,145,661	S301T	possibly damaging	Het
Virma	T	A	4: 11,521,261		probably null	Het
Vmn2r58	T	C	7: 41,864,298	D307G	probably benign	Het
Zeb2	T	C	2: 44,998,952	K327R	probably damaging	Het
Zfp54	C	T	17: 21,434,648	T468M	probably benign	Het
Zfp780b	A	T	7: 27,963,126	I668N	possibly damaging	Het

Other mutations in Usp8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Usp8	APN	2	126758560	missense	probably damaging	1.00
IGL00771:Usp8	APN	2	126725433	splice site	probably null
IGL01073:Usp8	APN	2	126718114	missense	probably damaging	0.96
IGL01722:Usp8	APN	2	126758152	missense	probably damaging	1.00
IGL02100:Usp8	APN	2	126737854	intron	probably benign
IGL02210:Usp8	APN	2	126718056	intron	probably benign
IGL02516:Usp8	APN	2	126742174	missense	probably benign	0.00
IGL02743:Usp8	APN	2	126734023	missense	probably damaging	1.00
IGL02953:Usp8	APN	2	126737937	missense	probably benign
satsuke	UTSW	2	126751111	missense	probably damaging	1.00
R0045:Usp8	UTSW	2	126742223	missense	probably benign	0.03
R0048:Usp8	UTSW	2	126737889	missense	probably damaging	0.96
R0048:Usp8	UTSW	2	126737889	missense	probably damaging	0.96
R0143:Usp8	UTSW	2	126755089	intron	probably benign
R0427:Usp8	UTSW	2	126718032	intron	probably benign
R0440:Usp8	UTSW	2	126725390	missense	probably benign	0.00
R0636:Usp8	UTSW	2	126720110	missense	possibly damaging	0.87
R0828:Usp8	UTSW	2	126742114	intron	probably benign
R1468:Usp8	UTSW	2	126754927	missense	probably damaging	1.00
R1468:Usp8	UTSW	2	126754927	missense	probably damaging	1.00
R1782:Usp8	UTSW	2	126720051	missense	probably damaging	1.00
R1860:Usp8	UTSW	2	126756040	missense	probably damaging	1.00
R2127:Usp8	UTSW	2	126737575	splice site	probably null
R2259:Usp8	UTSW	2	126758568	missense	probably benign	0.32
R2892:Usp8	UTSW	2	126758155	missense	probably damaging	1.00
R2893:Usp8	UTSW	2	126758155	missense	probably damaging	1.00
R3104:Usp8	UTSW	2	126758512	missense	probably damaging	1.00
R4074:Usp8	UTSW	2	126752370	missense	probably damaging	1.00
R4678:Usp8	UTSW	2	126725429	missense	probably null	1.00
R4715:Usp8	UTSW	2	126729222	missense	possibly damaging	0.80
R4832:Usp8	UTSW	2	126755038	missense	probably damaging	1.00
R4914:Usp8	UTSW	2	126720140	nonsense	probably null
R4915:Usp8	UTSW	2	126720140	nonsense	probably null
R4918:Usp8	UTSW	2	126720140	nonsense	probably null
R5262:Usp8	UTSW	2	126751111	missense	probably damaging	1.00
R5625:Usp8	UTSW	2	126742277	missense	probably damaging	1.00
R5667:Usp8	UTSW	2	126742425	missense	probably benign	0.00
R5671:Usp8	UTSW	2	126742425	missense	probably benign	0.00
R5984:Usp8	UTSW	2	126742481	missense	probably benign	0.10
R6529:Usp8	UTSW	2	126725378	missense	probably benign	0.01
R6551:Usp8	UTSW	2	126733182	intron	probably benign
R6885:Usp8	UTSW	2	126752310	missense	probably damaging	1.00
R7768:Usp8	UTSW	2	126751123	missense	probably damaging	1.00
R8097:Usp8	UTSW	2	126754880	missense	probably benign	0.44
R8130:Usp8	UTSW	2	126717998	intron	probably benign
R8379:Usp8	UTSW	2	126742571	missense	probably benign
Z1177:Usp8	UTSW	2	126758431	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACGTGACTCCACTGAGAATC -3'
(R):5'- TCACAGGCCTCAAAGGAAAG -3'

Sequencing Primer
(F):5'- GACAGCAAACAGACCAAGACGG -3'
(R):5'- GCAGAGAAGCCAATACCAATGGATC -3'

Posted On

2020-10-20