Mutagenetix > Incidental Mutations

Incidental Mutation 'R8412:Cdh26'

652724

Institutional Source

Beutler Lab

Gene Symbol

Cdh26

Ensembl Gene

ENSMUSG00000039155

Gene Name

cadherin-like 26

Synonyms

LOC381409

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8412 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

178430531-178487366 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 178462724 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 301 (I301V)

Ref Sequence

ENSEMBL: ENSMUSP00000048829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042092] [ENSMUST00000108912]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042092
AA Change: I301V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000048829
Gene: ENSMUSG00000039155
AA Change: I301V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	36	138	5.06e-2	SMART
CA	162	248	1.23e-19	SMART
CA	271	370	1.01e-6	SMART
CA	393	476	2.86e-20	SMART
transmembrane domain	592	614	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108912
AA Change: I301V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000104540
Gene: ENSMUSG00000039155
AA Change: I301V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	36	138	5.06e-2	SMART
CA	162	248	1.23e-19	SMART
CA	271	370	1.01e-6	SMART
CA	393	476	2.86e-20	SMART
transmembrane domain	592	614	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cadherin protein family. Cadherins are a family of calcium-dependent adhesion molecules that mediate cell-cell adhesion in all solid tissues and modulate a wide variety of processes, including cell polarization, migration and differentiation. Cadherin domains occur as repeats in the extracellular region and are thought to contribute to the sorting of heterogeneous cell types and the maintenance of orderly structures such as epithelium. This protein is expressed in gastrointestinal epithelial cells and may be upregulated during allergic inflammation. This protein interacts with alpha integrins and may also be involved in leukocyte migration and adhesion. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	T	A	1: 184,033,159	R234S	probably damaging	Het
Ace	T	A	11: 105,979,266	F806Y	probably benign	Het
Ak8	A	G	2: 28,739,631	T286A	probably benign	Het
Apba2	T	A	7: 64,745,798	F674Y	probably damaging	Het
Apob	A	G	12: 8,008,069	I2184V	probably benign	Het
Arhgap23	C	T	11: 97,466,028	P884L	probably benign	Het
Atg2a	T	C	19: 6,244,524	L90P	probably damaging	Het
Bhmt2	T	A	13: 93,662,312	I334F	possibly damaging	Het
Bmi1	C	T	2: 18,684,303	T266I	probably damaging	Het
Cenpx	A	T	11: 120,711,732	H68Q	unknown	Het
Cnot10	T	C	9: 114,610,670	R524G	probably benign	Het
Cnpy1	A	T	5: 28,209,208	Y22*	probably null	Het
Csmd3	C	T	15: 47,636,398	R2114H		Het
Defa29	T	A	8: 21,326,046	T102S	probably benign	Het
Fras1	T	C	5: 96,596,852	I582T	probably benign	Het
Gm14295	G	A	2: 176,809,629	C304Y	probably damaging	Het
Gucy2d	T	C	7: 98,443,839	V141A	possibly damaging	Het
Ifi47	A	C	11: 49,095,598	Q64P	probably damaging	Het
Irx3	G	T	8: 91,800,400	S225R	possibly damaging	Het
Itpr1	A	G	6: 108,363,620	H289R	probably benign	Het
Lamc3	A	G	2: 31,912,116	D512G	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Med23	C	A	10: 24,908,734	F1200L	probably benign	Het
Ndst4	A	T	3: 125,570,790	D372V	possibly damaging	Het
Nob1	T	A	8: 107,421,598	K71*	probably null	Het
Ntrk3	A	G	7: 78,356,149	I488T	probably benign	Het
Pds5b	G	T	5: 150,719,959	C82F	probably damaging	Het
Pkd1l3	T	A	8: 109,633,390	V969E	possibly damaging	Het
Ppme1	A	T	7: 100,335,091	N307K	probably benign	Het
Pus7l	C	T	15: 94,527,975	C515Y	probably benign	Het
Rpp21	T	A	17: 36,257,699	H22L	possibly damaging	Het
Scamp3	T	C	3: 89,181,218	F244L	probably damaging	Het
Scgb1b7	A	T	7: 31,712,954	K52*	probably null	Het
Slc12a3	T	C	8: 94,334,067	I261T	probably damaging	Het
Slc19a3	C	T	1: 83,014,812	R396H	probably damaging	Het
Slc22a14	T	C	9: 119,180,856	I58V	probably benign	Het
Slc9a9	A	C	9: 95,229,039	T637P	probably damaging	Het
Snrnp40	T	A	4: 130,384,523	C274S	possibly damaging	Het
Sptbn1	A	G	11: 30,138,457	V905A	probably damaging	Het
Taok3	A	G	5: 117,266,037	D759G	possibly damaging	Het
Tas1r1	T	C	4: 152,032,576	I200M	probably benign	Het
Tnfrsf25	T	C	4: 152,119,682	V360A	possibly damaging	Het
Trim12a	A	T	7: 104,304,337	M189K	possibly damaging	Het
Tspan32	T	C	7: 143,005,958	F41L	probably benign	Het
Tube1	T	A	10: 39,145,661	S301T	possibly damaging	Het
Usp8	T	C	2: 126,742,658	S596P	probably benign	Het
Virma	T	A	4: 11,521,261		probably null	Het
Vmn2r58	T	C	7: 41,864,298	D307G	probably benign	Het
Zeb2	T	C	2: 44,998,952	K327R	probably damaging	Het
Zfp54	C	T	17: 21,434,648	T468M	probably benign	Het
Zfp780b	A	T	7: 27,963,126	I668N	possibly damaging	Het

Other mutations in Cdh26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Cdh26	APN	2	178481624	missense	possibly damaging	0.86
IGL01341:Cdh26	APN	2	178457447	missense	probably damaging	0.99
IGL02636:Cdh26	APN	2	178449962	missense	probably damaging	1.00
IGL03144:Cdh26	APN	2	178468174	missense	probably damaging	0.99
R0244:Cdh26	UTSW	2	178481632	missense	possibly damaging	0.88
R0245:Cdh26	UTSW	2	178481632	missense	possibly damaging	0.88
R0466:Cdh26	UTSW	2	178481632	missense	possibly damaging	0.88
R0467:Cdh26	UTSW	2	178481632	missense	possibly damaging	0.88
R0514:Cdh26	UTSW	2	178466828	critical splice donor site	probably null
R0610:Cdh26	UTSW	2	178449898	missense	probably damaging	1.00
R0733:Cdh26	UTSW	2	178486931	missense	probably damaging	1.00
R1592:Cdh26	UTSW	2	178449891	missense	probably damaging	1.00
R2483:Cdh26	UTSW	2	178466589	missense	probably damaging	1.00
R3756:Cdh26	UTSW	2	178470001	splice site	probably benign
R4617:Cdh26	UTSW	2	178460642	intron	probably benign
R4914:Cdh26	UTSW	2	178449821	missense	probably benign	0.02
R4915:Cdh26	UTSW	2	178449821	missense	probably benign	0.02
R4917:Cdh26	UTSW	2	178449821	missense	probably benign	0.02
R4918:Cdh26	UTSW	2	178449821	missense	probably benign	0.02
R5086:Cdh26	UTSW	2	178441417	nonsense	probably null
R5573:Cdh26	UTSW	2	178466689	missense	probably damaging	0.96
R5809:Cdh26	UTSW	2	178460126	nonsense	probably null
R5941:Cdh26	UTSW	2	178481650	nonsense	probably null
R6284:Cdh26	UTSW	2	178449884	missense	probably damaging	1.00
R6341:Cdh26	UTSW	2	178471573	splice site	probably null
R6496:Cdh26	UTSW	2	178449861	missense	probably damaging	1.00
R7132:Cdh26	UTSW	2	178486762	missense	possibly damaging	0.56
R7664:Cdh26	UTSW	2	178470042	missense	probably benign	0.02
R7694:Cdh26	UTSW	2	178460103	missense	probably damaging	0.96
R7814:Cdh26	UTSW	2	178470035	missense	probably damaging	0.98
R8089:Cdh26	UTSW	2	178457577	critical splice donor site	probably null
R8103:Cdh26	UTSW	2	178468213	missense	probably damaging	1.00
R8413:Cdh26	UTSW	2	178468229	missense	probably damaging	0.99
RF002:Cdh26	UTSW	2	178466631	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCCAGTGACATGGAAAC -3'
(R):5'- GTCCTTGGCCTCTAGACAAAGG -3'

Sequencing Primer
(F):5'- TGGAAACGATGATTATTTCTTCCAG -3'
(R):5'- TCTAGACAAAGGGCTCATCTGCTC -3'

Posted On

2020-10-20