Mutagenetix > Incidental Mutations

Incidental Mutation 'R8412:Virma'

652727

Institutional Source

Beutler Lab

Gene Symbol

Virma

Ensembl Gene

ENSMUSG00000040720

Gene Name

vir like m6A methyltransferase associated

Synonyms

1110037F02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8412 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11485958-11550684 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 11521261 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000063188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055372] [ENSMUST00000059914] [ENSMUST00000108307]

Predicted Effect

probably null
Transcript: ENSMUST00000055372

SMART Domains

Protein: ENSMUSP00000063188
Gene: ENSMUSG00000040720

Domain	Start	End	E-Value	Type
low complexity region	139	153	N/A	INTRINSIC
low complexity region	172	198	N/A	INTRINSIC
low complexity region	236	267	N/A	INTRINSIC
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000059914

SMART Domains

Protein: ENSMUSP00000058078
Gene: ENSMUSG00000040720

Domain	Start	End	E-Value	Type
low complexity region	139	153	N/A	INTRINSIC
low complexity region	172	198	N/A	INTRINSIC
low complexity region	236	267	N/A	INTRINSIC
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1224	1232	N/A	INTRINSIC
low complexity region	1443	1458	N/A	INTRINSIC
low complexity region	1460	1474	N/A	INTRINSIC
low complexity region	1618	1634	N/A	INTRINSIC
low complexity region	1684	1697	N/A	INTRINSIC
low complexity region	1750	1757	N/A	INTRINSIC
low complexity region	1796	1808	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108307

SMART Domains

Protein: ENSMUSP00000103943
Gene: ENSMUSG00000040720

Domain	Start	End	E-Value	Type
Pfam:VIR_N	5	266	2e-110	PFAM
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1058	1070	N/A	INTRINSIC
low complexity region	1162	1174	N/A	INTRINSIC
low complexity region	1274	1282	N/A	INTRINSIC
low complexity region	1493	1508	N/A	INTRINSIC
low complexity region	1510	1524	N/A	INTRINSIC
low complexity region	1668	1684	N/A	INTRINSIC
low complexity region	1734	1747	N/A	INTRINSIC
low complexity region	1800	1807	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	T	A	1: 184,033,159	R234S	probably damaging	Het
Ace	T	A	11: 105,979,266	F806Y	probably benign	Het
Ak8	A	G	2: 28,739,631	T286A	probably benign	Het
Apba2	T	A	7: 64,745,798	F674Y	probably damaging	Het
Apob	A	G	12: 8,008,069	I2184V	probably benign	Het
Arhgap23	C	T	11: 97,466,028	P884L	probably benign	Het
Atg2a	T	C	19: 6,244,524	L90P	probably damaging	Het
Bhmt2	T	A	13: 93,662,312	I334F	possibly damaging	Het
Bmi1	C	T	2: 18,684,303	T266I	probably damaging	Het
Cdh26	A	G	2: 178,462,724	I301V	probably damaging	Het
Cenpx	A	T	11: 120,711,732	H68Q	unknown	Het
Cnot10	T	C	9: 114,610,670	R524G	probably benign	Het
Cnpy1	A	T	5: 28,209,208	Y22*	probably null	Het
Csmd3	C	T	15: 47,636,398	R2114H		Het
Defa29	T	A	8: 21,326,046	T102S	probably benign	Het
Fras1	T	C	5: 96,596,852	I582T	probably benign	Het
Gm14295	G	A	2: 176,809,629	C304Y	probably damaging	Het
Gucy2d	T	C	7: 98,443,839	V141A	possibly damaging	Het
Ifi47	A	C	11: 49,095,598	Q64P	probably damaging	Het
Irx3	G	T	8: 91,800,400	S225R	possibly damaging	Het
Itpr1	A	G	6: 108,363,620	H289R	probably benign	Het
Lamc3	A	G	2: 31,912,116	D512G	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Med23	C	A	10: 24,908,734	F1200L	probably benign	Het
Ndst4	A	T	3: 125,570,790	D372V	possibly damaging	Het
Nob1	T	A	8: 107,421,598	K71*	probably null	Het
Ntrk3	A	G	7: 78,356,149	I488T	probably benign	Het
Pds5b	G	T	5: 150,719,959	C82F	probably damaging	Het
Pkd1l3	T	A	8: 109,633,390	V969E	possibly damaging	Het
Ppme1	A	T	7: 100,335,091	N307K	probably benign	Het
Pus7l	C	T	15: 94,527,975	C515Y	probably benign	Het
Rpp21	T	A	17: 36,257,699	H22L	possibly damaging	Het
Scamp3	T	C	3: 89,181,218	F244L	probably damaging	Het
Scgb1b7	A	T	7: 31,712,954	K52*	probably null	Het
Slc12a3	T	C	8: 94,334,067	I261T	probably damaging	Het
Slc19a3	C	T	1: 83,014,812	R396H	probably damaging	Het
Slc22a14	T	C	9: 119,180,856	I58V	probably benign	Het
Slc9a9	A	C	9: 95,229,039	T637P	probably damaging	Het
Snrnp40	T	A	4: 130,384,523	C274S	possibly damaging	Het
Sptbn1	A	G	11: 30,138,457	V905A	probably damaging	Het
Taok3	A	G	5: 117,266,037	D759G	possibly damaging	Het
Tas1r1	T	C	4: 152,032,576	I200M	probably benign	Het
Tnfrsf25	T	C	4: 152,119,682	V360A	possibly damaging	Het
Trim12a	A	T	7: 104,304,337	M189K	possibly damaging	Het
Tspan32	T	C	7: 143,005,958	F41L	probably benign	Het
Tube1	T	A	10: 39,145,661	S301T	possibly damaging	Het
Usp8	T	C	2: 126,742,658	S596P	probably benign	Het
Vmn2r58	T	C	7: 41,864,298	D307G	probably benign	Het
Zeb2	T	C	2: 44,998,952	K327R	probably damaging	Het
Zfp54	C	T	17: 21,434,648	T468M	probably benign	Het
Zfp780b	A	T	7: 27,963,126	I668N	possibly damaging	Het

Other mutations in Virma

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Virma	APN	4	11519424	splice site	probably benign
IGL00477:Virma	APN	4	11519006	missense	probably damaging	0.99
IGL01293:Virma	APN	4	11521114	missense	probably damaging	1.00
IGL01410:Virma	APN	4	11518929	nonsense	probably null
IGL01531:Virma	APN	4	11528753	missense	probably damaging	1.00
IGL01672:Virma	APN	4	11527792	missense	probably damaging	1.00
IGL01724:Virma	APN	4	11528672	missense	probably damaging	1.00
IGL01747:Virma	APN	4	11526877	missense	probably damaging	1.00
IGL01776:Virma	APN	4	11527792	missense	probably damaging	1.00
IGL02064:Virma	APN	4	11513163	missense	possibly damaging	0.87
IGL02243:Virma	APN	4	11546031	missense	probably damaging	1.00
IGL02244:Virma	APN	4	11546031	missense	probably damaging	1.00
IGL02445:Virma	APN	4	11527029	missense	probably damaging	0.97
IGL02546:Virma	APN	4	11494804	missense	probably damaging	0.99
IGL02807:Virma	APN	4	11507079	splice site	probably benign
IGL02967:Virma	APN	4	11514096	missense	probably benign	0.01
IGL03211:Virma	APN	4	11548770	nonsense	probably null
IGL03242:Virma	APN	4	11527669	missense	possibly damaging	0.70
IGL03256:Virma	APN	4	11542207	splice site	probably benign
IGL03327:Virma	APN	4	11518984	missense	probably benign	0.00
IGL03346:Virma	APN	4	11518984	missense	probably benign	0.00
PIT4802001:Virma	UTSW	4	11546008	missense	probably damaging	0.99
R0142:Virma	UTSW	4	11548783	missense	probably benign	0.04
R0355:Virma	UTSW	4	11528626	nonsense	probably null
R0522:Virma	UTSW	4	11519416	critical splice donor site	probably null
R0600:Virma	UTSW	4	11498769	missense	probably damaging	0.99
R1435:Virma	UTSW	4	11528621	missense	probably damaging	1.00
R1489:Virma	UTSW	4	11521164	missense	probably damaging	1.00
R1568:Virma	UTSW	4	11528776	missense	probably damaging	0.99
R1616:Virma	UTSW	4	11544954	missense	probably damaging	1.00
R1655:Virma	UTSW	4	11494786	missense	probably damaging	1.00
R1695:Virma	UTSW	4	11494814	missense	probably damaging	0.98
R1835:Virma	UTSW	4	11540511	missense	probably benign	0.02
R1951:Virma	UTSW	4	11513907	missense	probably benign	0.00
R1991:Virma	UTSW	4	11519242	missense	probably benign	0.06
R2145:Virma	UTSW	4	11548726	splice site	probably benign
R2172:Virma	UTSW	4	11527843	missense	possibly damaging	0.82
R2217:Virma	UTSW	4	11544924	missense	probably damaging	1.00
R2218:Virma	UTSW	4	11544924	missense	probably damaging	1.00
R2248:Virma	UTSW	4	11518927	missense	probably damaging	1.00
R2342:Virma	UTSW	4	11501316	missense	probably damaging	1.00
R3424:Virma	UTSW	4	11513177	nonsense	probably null
R4397:Virma	UTSW	4	11513901	missense	possibly damaging	0.81
R4449:Virma	UTSW	4	11498828	critical splice donor site	probably null
R4660:Virma	UTSW	4	11513505	missense	probably damaging	1.00
R4698:Virma	UTSW	4	11528636	missense	probably damaging	0.99
R4878:Virma	UTSW	4	11544971	missense	probably damaging	1.00
R4937:Virma	UTSW	4	11521147	nonsense	probably null
R5031:Virma	UTSW	4	11542116	nonsense	probably null
R5040:Virma	UTSW	4	11528746	missense	probably benign	0.01
R5061:Virma	UTSW	4	11494840	missense	possibly damaging	0.95
R5091:Virma	UTSW	4	11519392	missense	probably benign	0.00
R5137:Virma	UTSW	4	11546297	missense	probably damaging	1.00
R5262:Virma	UTSW	4	11539926	missense	probably benign	0.01
R5297:Virma	UTSW	4	11494819	missense	probably damaging	1.00
R5730:Virma	UTSW	4	11542154	missense	probably benign	0.44
R5818:Virma	UTSW	4	11513319	missense	possibly damaging	0.92
R5835:Virma	UTSW	4	11514036	missense	probably damaging	1.00
R6125:Virma	UTSW	4	11521172	missense	probably damaging	0.98
R6197:Virma	UTSW	4	11505498	missense	probably damaging	0.96
R6222:Virma	UTSW	4	11527820	missense	probably damaging	1.00
R6793:Virma	UTSW	4	11539968	missense	probably damaging	1.00
R7028:Virma	UTSW	4	11519249	missense	possibly damaging	0.50
R7356:Virma	UTSW	4	11513595	missense	probably damaging	0.99
R7383:Virma	UTSW	4	11514026	missense	probably damaging	0.98
R7391:Virma	UTSW	4	11508099	missense	probably damaging	0.99
R7425:Virma	UTSW	4	11546211	missense	possibly damaging	0.95
R7556:Virma	UTSW	4	11518927	missense	probably damaging	1.00
R7715:Virma	UTSW	4	11549682	missense	probably damaging	1.00
R7715:Virma	UTSW	4	11513016	splice site	probably null
R7986:Virma	UTSW	4	11540023	missense	probably benign	0.01
R7990:Virma	UTSW	4	11513983	missense	probably benign	0.00
R8048:Virma	UTSW	4	11539918	nonsense	probably null
R8050:Virma	UTSW	4	11528643	missense	probably benign	0.22
R8544:Virma	UTSW	4	11516949	missense	probably benign
R8551:Virma	UTSW	4	11513397	missense	probably damaging	1.00
X0020:Virma	UTSW	4	11486055	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTAACCCTGATTTTATTCCAGCG -3'
(R):5'- GCTAGACTGCTACTTTTCAGGAC -3'

Sequencing Primer
(F):5'- TTCCAGCGATTCCAAGTCTAAG -3'
(R):5'- GCATGAGGCTCTCAGTTCAGATC -3'

Posted On

2020-10-20