Incidental Mutation 'R8412:Tas1r1'
ID652729
Institutional Source Beutler Lab
Gene Symbol Tas1r1
Ensembl Gene ENSMUSG00000028950
Gene Nametaste receptor, type 1, member 1
SynonymsTR1, T1r1, Gpr70, T1R1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location152027914-152038568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152032576 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 200 (I200M)
Ref Sequence ENSEMBL: ENSMUSP00000030792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030792] [ENSMUST00000066715] [ENSMUST00000131935] [ENSMUST00000155389]
Predicted Effect probably benign
Transcript: ENSMUST00000030792
AA Change: I200M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030792
Gene: ENSMUSG00000028950
AA Change: I200M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 456 1.7e-69 PFAM
Pfam:NCD3G 494 546 2.1e-15 PFAM
Pfam:7tm_3 578 815 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066715
SMART Domains Protein: ENSMUSP00000067521
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
ZnF_C2H2 400 423 2.49e-1 SMART
ZnF_C2H2 429 452 2.57e-3 SMART
ZnF_C2H2 458 480 9.73e-4 SMART
ZnF_C2H2 486 508 3.21e-4 SMART
ZnF_C2H2 514 537 1.67e-2 SMART
ZnF_C2H2 543 565 1.95e-3 SMART
ZnF_C2H2 571 593 5.67e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131935
SMART Domains Protein: ENSMUSP00000116423
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155389
SMART Domains Protein: ENSMUSP00000114726
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
low complexity region 403 418 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor and is a component of the heterodimeric amino acid taste receptor T1R1+3. The T1R1+3 receptor responds to L-amino acids but not to D-enantiomers or other compounds. Most amino acids that are perceived as sweet activate T1R1+3, and this activation is strictly dependent on an intact T1R1+3 heterodimer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to umami tastants. Response to sweet tastants is unimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Tas1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02708:Tas1r1 APN 4 152028340 missense possibly damaging 0.82
IGL02867:Tas1r1 APN 4 152028278 missense probably damaging 1.00
R1547:Tas1r1 UTSW 4 152028419 missense probably damaging 1.00
R1775:Tas1r1 UTSW 4 152038218 nonsense probably null
R1803:Tas1r1 UTSW 4 152032248 missense probably damaging 0.99
R2037:Tas1r1 UTSW 4 152028170 missense probably damaging 1.00
R2083:Tas1r1 UTSW 4 152028391 missense probably benign 0.02
R3821:Tas1r1 UTSW 4 152034681 missense probably benign
R3912:Tas1r1 UTSW 4 152031924 missense probably damaging 0.97
R4227:Tas1r1 UTSW 4 152028272 missense probably damaging 0.99
R4272:Tas1r1 UTSW 4 152032157 missense possibly damaging 0.70
R4273:Tas1r1 UTSW 4 152032157 missense possibly damaging 0.70
R4818:Tas1r1 UTSW 4 152032674 missense probably benign 0.15
R5567:Tas1r1 UTSW 4 152038325 missense probably damaging 0.99
R6183:Tas1r1 UTSW 4 152032541 missense probably damaging 1.00
R7162:Tas1r1 UTSW 4 152032238 missense possibly damaging 0.91
R7427:Tas1r1 UTSW 4 152038308 missense probably benign 0.39
R7535:Tas1r1 UTSW 4 152028362 missense probably benign 0.06
R7736:Tas1r1 UTSW 4 152032466 missense probably benign 0.17
R7796:Tas1r1 UTSW 4 152034755 missense probably benign 0.01
R7921:Tas1r1 UTSW 4 152028661 missense possibly damaging 0.88
R8078:Tas1r1 UTSW 4 152028346 missense probably damaging 1.00
R8255:Tas1r1 UTSW 4 152032317 missense probably benign 0.18
Z1177:Tas1r1 UTSW 4 152032214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAGAGAAGACCACGACCACGG -3'
(R):5'- AACTCCATAGAGCGTCCTGC -3'

Sequencing Primer
(F):5'- GAGCCAGACGCAGCATCATG -3'
(R):5'- CCTGTACTGGGTGGGCACTG -3'
Posted On2020-10-20