Incidental Mutation 'R8412:Pds5b'
ID652734
Institutional Source Beutler Lab
Gene Symbol Pds5b
Ensembl Gene ENSMUSG00000034021
Gene NamePDS5 cohesin associated factor B
SynonymsAprin, AS3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location150673739-150810690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 150719959 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 82 (C82F)
Ref Sequence ENSEMBL: ENSMUSP00000016569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016569] [ENSMUST00000038900] [ENSMUST00000202170]
Predicted Effect probably damaging
Transcript: ENSMUST00000016569
AA Change: C82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016569
Gene: ENSMUSG00000034021
AA Change: C82F

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1247 1259 4.14e1 SMART
AT_hook 1285 1297 1.35e2 SMART
low complexity region 1307 1316 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
AT_hook 1370 1382 1.46e0 SMART
low complexity region 1437 1446 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000038900
AA Change: C82F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038421
Gene: ENSMUSG00000034021
AA Change: C82F

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1373 1385 1.46e0 SMART
low complexity region 1440 1449 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202170
AA Change: C82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144572
Gene: ENSMUSG00000034021
AA Change: C82F

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1372 1384 1.46e0 SMART
low complexity region 1439 1448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality with cardiac defects, craniofacial abnormalities, axial skeletal defects, shortening of most of the long bones, abnormal enteric nervous system morphology, and decreased germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Pds5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Pds5b APN 5 150722542 missense probably benign 0.25
IGL01530:Pds5b APN 5 150792175 missense probably benign 0.38
IGL01812:Pds5b APN 5 150780689 missense probably damaging 1.00
IGL02163:Pds5b APN 5 150756406 missense probably benign 0.00
IGL02730:Pds5b APN 5 150780752 splice site probably benign
IGL02825:Pds5b APN 5 150728970 missense possibly damaging 0.90
IGL03143:Pds5b APN 5 150779257 missense probably damaging 1.00
IGL03379:Pds5b APN 5 150788331 missense probably damaging 1.00
PIT4283001:Pds5b UTSW 5 150778309 missense probably damaging 0.99
R0026:Pds5b UTSW 5 150749830 splice site probably benign
R0197:Pds5b UTSW 5 150754431 missense probably benign 0.28
R0347:Pds5b UTSW 5 150736427 splice site probably benign
R0396:Pds5b UTSW 5 150779275 missense possibly damaging 0.96
R0400:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R0442:Pds5b UTSW 5 150716544 splice site probably benign
R0745:Pds5b UTSW 5 150805671 missense probably benign
R0839:Pds5b UTSW 5 150764962 missense probably benign 0.23
R0866:Pds5b UTSW 5 150739191 splice site probably benign
R1247:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R1330:Pds5b UTSW 5 150761077 missense probably damaging 0.97
R1440:Pds5b UTSW 5 150754417 missense probably damaging 1.00
R1526:Pds5b UTSW 5 150716400 splice site probably null
R2010:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R2051:Pds5b UTSW 5 150748190 missense probably damaging 1.00
R2507:Pds5b UTSW 5 150756428 missense possibly damaging 0.90
R3111:Pds5b UTSW 5 150719907 missense probably damaging 1.00
R3820:Pds5b UTSW 5 150736337 missense possibly damaging 0.94
R3911:Pds5b UTSW 5 150746706 missense probably benign 0.41
R4077:Pds5b UTSW 5 150794359 missense possibly damaging 0.62
R4118:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R4342:Pds5b UTSW 5 150800854 missense probably benign 0.17
R4416:Pds5b UTSW 5 150736396 missense probably damaging 1.00
R4503:Pds5b UTSW 5 150728934 missense probably damaging 1.00
R4524:Pds5b UTSW 5 150788316 missense probably damaging 1.00
R4579:Pds5b UTSW 5 150746732 missense probably damaging 0.98
R4623:Pds5b UTSW 5 150800601 missense probably benign 0.37
R4847:Pds5b UTSW 5 150748112 missense probably damaging 1.00
R4885:Pds5b UTSW 5 150716462 missense probably benign 0.21
R5271:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R5281:Pds5b UTSW 5 150746608 missense probably benign 0.26
R5337:Pds5b UTSW 5 150793597 missense probably benign 0.03
R5635:Pds5b UTSW 5 150778221 missense possibly damaging 0.78
R5677:Pds5b UTSW 5 150716461 missense possibly damaging 0.91
R6005:Pds5b UTSW 5 150769776 splice site probably null
R6139:Pds5b UTSW 5 150800777 missense possibly damaging 0.81
R6225:Pds5b UTSW 5 150746618 missense probably damaging 0.98
R6279:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6300:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6666:Pds5b UTSW 5 150778166 missense probably damaging 1.00
R6805:Pds5b UTSW 5 150805561 splice site probably null
R7038:Pds5b UTSW 5 150800760 missense probably benign 0.02
R7046:Pds5b UTSW 5 150749920 missense probably damaging 1.00
R7051:Pds5b UTSW 5 150794282 missense possibly damaging 0.78
R7138:Pds5b UTSW 5 150800677 nonsense probably null
R7255:Pds5b UTSW 5 150796667 missense probably benign 0.33
R7467:Pds5b UTSW 5 150736327 missense probably damaging 0.99
R7488:Pds5b UTSW 5 150723337 missense probably damaging 0.97
R7512:Pds5b UTSW 5 150788342 missense probably damaging 1.00
R7561:Pds5b UTSW 5 150739318 critical splice donor site probably null
R7576:Pds5b UTSW 5 150778261 missense probably damaging 1.00
R7889:Pds5b UTSW 5 150792172 missense probably damaging 1.00
R7982:Pds5b UTSW 5 150769941 missense probably damaging 1.00
R8059:Pds5b UTSW 5 150807835 missense unknown
R8211:Pds5b UTSW 5 150728942 missense possibly damaging 0.90
R8503:Pds5b UTSW 5 150716507 missense possibly damaging 0.95
R8556:Pds5b UTSW 5 150792608 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGAAACGTCTGACTATTTGATG -3'
(R):5'- CCTTAATCTGCTTACTCTGGGG -3'

Sequencing Primer
(F):5'- ACGTCTGACTATTTGATGATCTTTG -3'
(R):5'- AATCTGCTTACTCTGGGGGTCAG -3'
Posted On2020-10-20