Incidental Mutation 'R8412:Scgb1b7'
ID652737
Institutional Source Beutler Lab
Gene Symbol Scgb1b7
Ensembl Gene ENSMUSG00000078759
Gene Namesecretoglobin, family 1B, member 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8412 (G1)
Quality Score147.008
Status Not validated
Chromosome7
Chromosomal Location31712665-31713978 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 31712954 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 52 (K52*)
Ref Sequence ENSEMBL: ENSMUSP00000103732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108097]
Predicted Effect probably null
Transcript: ENSMUST00000108097
AA Change: K52*
SMART Domains Protein: ENSMUSP00000103732
Gene: ENSMUSG00000078759
AA Change: K52*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
UTG 24 93 2.95e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Scgb1b7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6798:Scgb1b7 UTSW 7 31712981 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTATCCAGGCTCTCACAC -3'
(R):5'- GCAGTCTGAGAGTTCCTTCC -3'

Sequencing Primer
(F):5'- ACCCTCTAACCCCTGGGATATACTG -3'
(R):5'- GACATCCTCAATCCGGTGTG -3'
Posted On2020-10-20