Mutagenetix > Incidental Mutations

Incidental Mutation 'R8412:Ntrk3'

652740

Institutional Source

Beutler Lab

Gene Symbol

Ntrk3

Ensembl Gene

ENSMUSG00000059146

Gene Name

neurotrophic tyrosine kinase, receptor, type 3

Synonyms

TrkC

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8412 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78175959-78738012 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78356149 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 488 (I488T)

Ref Sequence

ENSEMBL: ENSMUSP00000037909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000039438] [ENSMUST00000193002] [ENSMUST00000195262]

Predicted Effect

probably benign
Transcript: ENSMUST00000039431
AA Change: I488T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146
AA Change: I488T

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	2.4e-8	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	810	1.49e-145	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000039438
AA Change: I488T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000038324
Gene: ENSMUSG00000059146
AA Change: I488T

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	3.1e-8	PFAM
transmembrane domain	429	451	N/A	INTRINSIC
PDB:2MFQ\|B	497	517	2e-6	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000193002
AA Change: I488T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146
AA Change: I488T

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	2.4e-8	PFAM
Pfam:Ig_2	312	392	6.9e-4	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	824	4.29e-137	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000195262
AA Change: I488T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146
AA Change: I488T

Domain	Start	End	E-Value	Type
LRRNT	31	63	1.2e-6	SMART
LRRCT	160	208	1.8e-14	SMART
IG	216	302	5.1e-11	SMART
Pfam:I-set	308	392	4.7e-7	PFAM
Pfam:Ig_2	312	392	1.3e-2	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	849	9.7e-132	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000206599

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	T	A	1: 184,033,159	R234S	probably damaging	Het
Ace	T	A	11: 105,979,266	F806Y	probably benign	Het
Ak8	A	G	2: 28,739,631	T286A	probably benign	Het
Apba2	T	A	7: 64,745,798	F674Y	probably damaging	Het
Apob	A	G	12: 8,008,069	I2184V	probably benign	Het
Arhgap23	C	T	11: 97,466,028	P884L	probably benign	Het
Atg2a	T	C	19: 6,244,524	L90P	probably damaging	Het
Bhmt2	T	A	13: 93,662,312	I334F	possibly damaging	Het
Bmi1	C	T	2: 18,684,303	T266I	probably damaging	Het
Cdh26	A	G	2: 178,462,724	I301V	probably damaging	Het
Cenpx	A	T	11: 120,711,732	H68Q	unknown	Het
Cnot10	T	C	9: 114,610,670	R524G	probably benign	Het
Cnpy1	A	T	5: 28,209,208	Y22*	probably null	Het
Csmd3	C	T	15: 47,636,398	R2114H		Het
Defa29	T	A	8: 21,326,046	T102S	probably benign	Het
Fras1	T	C	5: 96,596,852	I582T	probably benign	Het
Gm14295	G	A	2: 176,809,629	C304Y	probably damaging	Het
Gucy2d	T	C	7: 98,443,839	V141A	possibly damaging	Het
Ifi47	A	C	11: 49,095,598	Q64P	probably damaging	Het
Irx3	G	T	8: 91,800,400	S225R	possibly damaging	Het
Itpr1	A	G	6: 108,363,620	H289R	probably benign	Het
Lamc3	A	G	2: 31,912,116	D512G	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Med23	C	A	10: 24,908,734	F1200L	probably benign	Het
Ndst4	A	T	3: 125,570,790	D372V	possibly damaging	Het
Nob1	T	A	8: 107,421,598	K71*	probably null	Het
Pds5b	G	T	5: 150,719,959	C82F	probably damaging	Het
Pkd1l3	T	A	8: 109,633,390	V969E	possibly damaging	Het
Ppme1	A	T	7: 100,335,091	N307K	probably benign	Het
Pus7l	C	T	15: 94,527,975	C515Y	probably benign	Het
Rpp21	T	A	17: 36,257,699	H22L	possibly damaging	Het
Scamp3	T	C	3: 89,181,218	F244L	probably damaging	Het
Scgb1b7	A	T	7: 31,712,954	K52*	probably null	Het
Slc12a3	T	C	8: 94,334,067	I261T	probably damaging	Het
Slc19a3	C	T	1: 83,014,812	R396H	probably damaging	Het
Slc22a14	T	C	9: 119,180,856	I58V	probably benign	Het
Slc9a9	A	C	9: 95,229,039	T637P	probably damaging	Het
Snrnp40	T	A	4: 130,384,523	C274S	possibly damaging	Het
Sptbn1	A	G	11: 30,138,457	V905A	probably damaging	Het
Taok3	A	G	5: 117,266,037	D759G	possibly damaging	Het
Tas1r1	T	C	4: 152,032,576	I200M	probably benign	Het
Tnfrsf25	T	C	4: 152,119,682	V360A	possibly damaging	Het
Trim12a	A	T	7: 104,304,337	M189K	possibly damaging	Het
Tspan32	T	C	7: 143,005,958	F41L	probably benign	Het
Tube1	T	A	10: 39,145,661	S301T	possibly damaging	Het
Usp8	T	C	2: 126,742,658	S596P	probably benign	Het
Virma	T	A	4: 11,521,261		probably null	Het
Vmn2r58	T	C	7: 41,864,298	D307G	probably benign	Het
Zeb2	T	C	2: 44,998,952	K327R	probably damaging	Het
Zfp54	C	T	17: 21,434,648	T468M	probably benign	Het
Zfp780b	A	T	7: 27,963,126	I668N	possibly damaging	Het

Other mutations in Ntrk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Ntrk3	APN	7	78250873	missense	probably benign	0.03
IGL00862:Ntrk3	APN	7	78247177	missense	probably damaging	1.00
IGL00972:Ntrk3	APN	7	78247322	missense	possibly damaging	0.95
IGL00976:Ntrk3	APN	7	78450953	missense	probably benign	0.02
IGL02172:Ntrk3	APN	7	78460272	splice site	probably benign
IGL02175:Ntrk3	APN	7	78247228	missense	probably damaging	1.00
IGL02213:Ntrk3	APN	7	78462931	missense	probably benign	0.17
IGL02363:Ntrk3	APN	7	78453337	missense	probably benign	0.24
IGL02527:Ntrk3	APN	7	78451949	missense	probably benign
IGL02673:Ntrk3	APN	7	78250764	missense	probably damaging	1.00
IGL02755:Ntrk3	APN	7	78460439	missense	probably benign
IGL02998:Ntrk3	APN	7	78577657	missense	probably damaging	0.98
IGL03235:Ntrk3	APN	7	78192592	missense	probably damaging	1.00
R1465:Ntrk3	UTSW	7	78356014	splice site	probably benign
R1505:Ntrk3	UTSW	7	78460524	missense	probably damaging	0.99
R1638:Ntrk3	UTSW	7	78247288	missense	probably damaging	1.00
R1641:Ntrk3	UTSW	7	78356074	missense	probably damaging	1.00
R1775:Ntrk3	UTSW	7	78356041	missense	possibly damaging	0.60
R1786:Ntrk3	UTSW	7	78477935	splice site	probably benign
R1827:Ntrk3	UTSW	7	78247301	missense	probably damaging	1.00
R1868:Ntrk3	UTSW	7	78192604	missense	possibly damaging	0.90
R1873:Ntrk3	UTSW	7	78462839	missense	probably benign
R1929:Ntrk3	UTSW	7	78516723	splice site	probably null
R1941:Ntrk3	UTSW	7	78247262	missense	probably damaging	1.00
R2132:Ntrk3	UTSW	7	78477935	splice site	probably benign
R2214:Ntrk3	UTSW	7	78516772	missense	probably damaging	1.00
R2221:Ntrk3	UTSW	7	78198852	missense	probably damaging	1.00
R2223:Ntrk3	UTSW	7	78198852	missense	probably damaging	1.00
R2271:Ntrk3	UTSW	7	78516723	splice site	probably null
R2441:Ntrk3	UTSW	7	78302662	missense	probably damaging	1.00
R3108:Ntrk3	UTSW	7	78460515	missense	probably benign	0.01
R3109:Ntrk3	UTSW	7	78460515	missense	probably benign	0.01
R3959:Ntrk3	UTSW	7	78198842	missense	probably damaging	1.00
R4016:Ntrk3	UTSW	7	78462947	splice site	probably benign
R4028:Ntrk3	UTSW	7	78192710	missense	probably damaging	1.00
R4067:Ntrk3	UTSW	7	78517437	missense	probably damaging	1.00
R4398:Ntrk3	UTSW	7	78250769	nonsense	probably null
R4664:Ntrk3	UTSW	7	78461099	missense	probably damaging	0.99
R5045:Ntrk3	UTSW	7	78460424	missense	probably benign	0.13
R5081:Ntrk3	UTSW	7	78577774	missense	probably damaging	0.99
R5151:Ntrk3	UTSW	7	78247300	missense	probably damaging	1.00
R5249:Ntrk3	UTSW	7	78461166	missense	possibly damaging	0.87
R5294:Ntrk3	UTSW	7	78517506	splice site	probably null
R5594:Ntrk3	UTSW	7	78451899	missense	probably benign	0.10
R5923:Ntrk3	UTSW	7	78451928	missense	possibly damaging	0.61
R6878:Ntrk3	UTSW	7	78304372	missense	probably benign	0.00
R7083:Ntrk3	UTSW	7	78250839	missense	probably damaging	1.00
R7178:Ntrk3	UTSW	7	78356147	missense	possibly damaging	0.86
R7487:Ntrk3	UTSW	7	78250713	missense	probably damaging	1.00
R7607:Ntrk3	UTSW	7	78250873	missense	probably benign	0.03
R7800:Ntrk3	UTSW	7	78302740	missense	probably benign	0.09
R7961:Ntrk3	UTSW	7	78453328	missense	probably benign
R7976:Ntrk3	UTSW	7	78356206	missense	probably damaging	0.97
R8009:Ntrk3	UTSW	7	78453328	missense	probably benign
R8032:Ntrk3	UTSW	7	78356059	missense	probably damaging	1.00
R8104:Ntrk3	UTSW	7	78577702	missense	probably damaging	0.99
R8230:Ntrk3	UTSW	7	78250770	missense	probably damaging	1.00
R8254:Ntrk3	UTSW	7	78192578	missense	probably damaging	1.00
R8465:Ntrk3	UTSW	7	78462883	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCAGAGACATGGTTTGCTTCC -3'
(R):5'- TCAAGGAAGTGAATTTGGCTGG -3'

Sequencing Primer
(F):5'- AGAGACATGGTTTGCTTCCATACC -3'
(R):5'- TCAGGGAAATTGAGCAATACTTATC -3'

Posted On

2020-10-20