Incidental Mutation 'R8412:Gucy2d'
ID652741
Institutional Source Beutler Lab
Gene Symbol Gucy2d
Ensembl Gene ENSMUSG00000074003
Gene Nameguanylate cyclase 2d
Synonymsguanylyl cyclase D
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location98440416-98477479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98443839 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 141 (V141A)
Ref Sequence ENSEMBL: ENSMUSP00000146093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098274] [ENSMUST00000206435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098274
AA Change: V140A

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095875
Gene: ENSMUSG00000074003
AA Change: V140A

DomainStartEndE-ValueType
low complexity region 39 65 N/A INTRINSIC
Pfam:ANF_receptor 88 421 6.7e-49 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Pfam:Pkinase_Tyr 562 811 1.4e-33 PFAM
Pfam:Pkinase 575 811 1.3e-28 PFAM
CYCc 850 1045 8.67e-102 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000206435
AA Change: V141A

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozugous for a null allele lack olfactory response to uroguanylin and guanylin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Gucy2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Gucy2d APN 7 98449963 missense probably benign 0.03
IGL02093:Gucy2d APN 7 98443548 nonsense probably null
IGL02839:Gucy2d APN 7 98443989 missense possibly damaging 0.81
IGL02904:Gucy2d APN 7 98462189 splice site probably null
IGL03253:Gucy2d APN 7 98451664 missense probably benign 0.03
IGL03349:Gucy2d APN 7 98449841 missense possibly damaging 0.75
R0025:Gucy2d UTSW 7 98467752 missense probably benign
R0362:Gucy2d UTSW 7 98443685 missense probably damaging 1.00
R0379:Gucy2d UTSW 7 98459002 splice site probably null
R0381:Gucy2d UTSW 7 98459002 splice site probably null
R0507:Gucy2d UTSW 7 98459002 splice site probably null
R0890:Gucy2d UTSW 7 98473265 missense probably benign 0.43
R1720:Gucy2d UTSW 7 98477230 missense probably benign 0.28
R1721:Gucy2d UTSW 7 98454061 missense probably damaging 0.99
R1867:Gucy2d UTSW 7 98454061 missense probably damaging 0.99
R1868:Gucy2d UTSW 7 98454061 missense probably damaging 0.99
R1884:Gucy2d UTSW 7 98451608 missense probably benign 0.00
R1913:Gucy2d UTSW 7 98443847 missense probably benign 0.14
R2351:Gucy2d UTSW 7 98464019 missense probably benign 0.02
R4683:Gucy2d UTSW 7 98453443 missense probably benign 0.33
R5079:Gucy2d UTSW 7 98458268 critical splice acceptor site probably null
R5285:Gucy2d UTSW 7 98458267 splice site probably null
R5433:Gucy2d UTSW 7 98449775 missense probably damaging 1.00
R5859:Gucy2d UTSW 7 98451883 missense probably benign
R6148:Gucy2d UTSW 7 98443823 missense probably benign
R6468:Gucy2d UTSW 7 98449961 missense probably benign 0.00
R6909:Gucy2d UTSW 7 98467625 missense probably damaging 0.99
R7400:Gucy2d UTSW 7 98443640 missense possibly damaging 0.95
R7483:Gucy2d UTSW 7 98449757 missense probably damaging 1.00
R7707:Gucy2d UTSW 7 98451669 missense possibly damaging 0.75
R7903:Gucy2d UTSW 7 98459065 missense probably damaging 1.00
R8277:Gucy2d UTSW 7 98443475 missense probably benign
R8466:Gucy2d UTSW 7 98450030 missense probably damaging 0.98
R8520:Gucy2d UTSW 7 98472306 missense probably null 1.00
RF030:Gucy2d UTSW 7 98459034 small insertion probably benign
RF055:Gucy2d UTSW 7 98459041 small insertion probably benign
RF064:Gucy2d UTSW 7 98459043 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GACTGTGACCCCATCTTTGC -3'
(R):5'- CTGTGGTTACCCAGATGTCC -3'

Sequencing Primer
(F):5'- GACCCCATCTTTGCCCAGG -3'
(R):5'- TCCTGGTGAGAGGACACAATG -3'
Posted On2020-10-20