Incidental Mutation 'R8412:Tspan32'
ID652744
Institutional Source Beutler Lab
Gene Symbol Tspan32
Ensembl Gene ENSMUSG00000000244
Gene Nametetraspanin 32
SynonymsArt-1, Tssc6, Phemx, Tspan32, D7Wsu37e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location143005046-143019644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143005958 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 41 (F41L)
Ref Sequence ENSEMBL: ENSMUSP00000009396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009396] [ENSMUST00000075172] [ENSMUST00000082008] [ENSMUST00000105923] [ENSMUST00000105924] [ENSMUST00000105925] [ENSMUST00000143512] [ENSMUST00000145212] [ENSMUST00000207211]
Predicted Effect probably benign
Transcript: ENSMUST00000009396
AA Change: F41L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000009396
Gene: ENSMUSG00000000244
AA Change: F41L

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 223 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075172
AA Change: F14L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074667
Gene: ENSMUSG00000000244
AA Change: F14L

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 198 3.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082008
AA Change: F14L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080668
Gene: ENSMUSG00000000244
AA Change: F14L

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 146 7.1e-13 PFAM
transmembrane domain 155 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105923
AA Change: F14L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101543
Gene: ENSMUSG00000000244
AA Change: F14L

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
transmembrane domain 121 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105924
AA Change: F14L

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101544
Gene: ENSMUSG00000000244
AA Change: F14L

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 148 1.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105925
AA Change: F14L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101545
Gene: ENSMUSG00000000244
AA Change: F14L

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143512
AA Change: F11L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115344
Gene: ENSMUSG00000000244
AA Change: F11L

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145212
AA Change: F14L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116212
Gene: ENSMUSG00000000244
AA Change: F14L

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207211
AA Change: F14L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is a member of the tetraspanin superfamily, is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. This gene is located among several imprinted genes; however, this gene, as well as the tumor-suppressing subchromosomal transferable fragment 4, escapes imprinting. This gene may play a role in malignancies and diseases that involve this region, and it is also involved in hematopoietic cell function. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap null mutation exhibit normal hematopoiesis, hemolytic and granulopoitic responses. B cells exhibit normal proliferative responses while T cells demonstrate enhanced proliferation upon T cell receptor stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Tspan32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Tspan32 APN 7 143014954 intron probably benign
IGL02122:Tspan32 APN 7 143015635 missense probably damaging 0.99
IGL02830:Tspan32 APN 7 143017592 missense possibly damaging 0.93
theron UTSW 7 143017591 missense probably benign 0.37
R0594:Tspan32 UTSW 7 143015610 missense probably damaging 0.98
R1162:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R1317:Tspan32 UTSW 7 143017591 missense probably benign 0.37
R1513:Tspan32 UTSW 7 143005149 missense probably null 0.05
R2941:Tspan32 UTSW 7 143014992 missense probably damaging 1.00
R3953:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R3955:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R3957:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R5021:Tspan32 UTSW 7 143014978 missense probably damaging 1.00
R5849:Tspan32 UTSW 7 143015587 missense probably damaging 1.00
R6429:Tspan32 UTSW 7 143018742 missense possibly damaging 0.59
R7205:Tspan32 UTSW 7 143005126 missense possibly damaging 0.66
R7756:Tspan32 UTSW 7 143017222 missense probably benign 0.32
R8218:Tspan32 UTSW 7 143011095 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCTGTGCACCAAGGAAGC -3'
(R):5'- TGTTAGTCCAACCCAGACACTG -3'

Sequencing Primer
(F):5'- TGTGCACCAAGGAAGCTGGAG -3'
(R):5'- GACCTCTGGTTTTTGGCCAAAGC -3'
Posted On2020-10-20