Incidental Mutation 'R8412:Irx3'
ID652746
Institutional Source Beutler Lab
Gene Symbol Irx3
Ensembl Gene ENSMUSG00000031734
Gene NameIroquois related homeobox 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location91798525-91802067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 91800400 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 225 (S225R)
Ref Sequence ENSEMBL: ENSMUSP00000091002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093312] [ENSMUST00000175795]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093312
AA Change: S225R

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091002
Gene: ENSMUSG00000031734
AA Change: S225R

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
HOX 131 195 3.47e-12 SMART
coiled coil region 210 244 N/A INTRINSIC
low complexity region 294 300 N/A INTRINSIC
IRO 345 362 2.66e-6 SMART
low complexity region 365 384 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
low complexity region 436 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175795
AA Change: S225R

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135488
Gene: ENSMUSG00000031734
AA Change: S225R

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
HOX 131 195 3.47e-12 SMART
coiled coil region 210 244 N/A INTRINSIC
low complexity region 294 300 N/A INTRINSIC
IRO 345 362 2.66e-6 SMART
low complexity region 365 384 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
low complexity region 436 461 N/A INTRINSIC
low complexity region 495 507 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRX3 is a member of the Iroquois homeobox gene family (see IRX1; MIM 606197) and plays a role in an early step of neural development (Bellefroid et al., 1998 [PubMed 9427753]). Members of this family appear to play multiple roles during pattern formation of vertebrate embryos (Lewis et al., 1999 [PubMed 10370142]).[supplied by OMIM, Aug 2009]
PHENOTYPE: Mice homozygous for a null allele display right bundle branch block, decreased body weight, increased energy expenditure, reduced adiposity and decreased susceptibility to diet induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Irx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0058:Irx3 UTSW 8 91800540 missense possibly damaging 0.88
R0080:Irx3 UTSW 8 91800326 missense possibly damaging 0.94
R0402:Irx3 UTSW 8 91800668 missense possibly damaging 0.77
R0418:Irx3 UTSW 8 91800080 missense probably benign 0.00
R0609:Irx3 UTSW 8 91801093 missense probably benign 0.18
R0709:Irx3 UTSW 8 91799420 missense possibly damaging 0.94
R1753:Irx3 UTSW 8 91800734 missense probably damaging 0.98
R3406:Irx3 UTSW 8 91798927 missense unknown
R5472:Irx3 UTSW 8 91799480 splice site probably null
R5790:Irx3 UTSW 8 91799676 missense probably benign
R5896:Irx3 UTSW 8 91801135 missense probably benign
R6611:Irx3 UTSW 8 91800003 missense probably damaging 0.97
R6776:Irx3 UTSW 8 91799835 missense probably benign 0.00
R6861:Irx3 UTSW 8 91798902 utr 3 prime probably benign
R6978:Irx3 UTSW 8 91800728 missense probably damaging 0.99
R7472:Irx3 UTSW 8 91799997 missense probably benign 0.25
R8304:Irx3 UTSW 8 91800206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGCTAGTTTTGCAGTCCG -3'
(R):5'- GAAGATCATGTTGGCCATCATCAC -3'

Sequencing Primer
(F):5'- TTGCAGTCCGAAATGGGTCC -3'
(R):5'- CCAAGATGACCCTCACCCAGG -3'
Posted On2020-10-20