Incidental Mutation 'R8412:Slc12a3'
ID652747
Institutional Source Beutler Lab
Gene Symbol Slc12a3
Ensembl Gene ENSMUSG00000031766
Gene Namesolute carrier family 12, member 3
SynonymsNCC, TSC
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location94329201-94366214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94334067 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 261 (I261T)
Ref Sequence ENSEMBL: ENSMUSP00000034218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034218] [ENSMUST00000212134]
Predicted Effect probably damaging
Transcript: ENSMUST00000034218
AA Change: I261T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034218
Gene: ENSMUSG00000031766
AA Change: I261T

DomainStartEndE-ValueType
Pfam:AA_permease_N 43 114 1.5e-30 PFAM
Pfam:AA_permease 139 645 3.6e-145 PFAM
Pfam:SLC12 653 801 1.4e-53 PFAM
Pfam:SLC12 787 1001 2e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212134
AA Change: I261T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a renal thiazide-sensitive sodium-chloride cotransporter that is important for electrolyte homeostasis. This cotransporter mediates sodium and chloride reabsorption in the distal convoluted tubule. Mutations in this gene cause Gitelman syndrome, a disease similar to Bartter's syndrome, that is characterized by hypokalemic alkalosis combined with hypomagnesemia, low urinary calcium, and increased renin activity associated with normal blood pressure. This cotransporter is the target for thiazide diuretics that are used for treating high blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomagnesemia, hypocalciurua and abnormal renal distal convoluted tubule morphology, and show significantly reduced arterial blood pressure on a sodium-depleted diet. Mutant kidney cortical collecting ductsdisplay thiazide-sensitive NaCl absorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Slc12a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Slc12a3 APN 8 94357096 missense probably benign 0.00
IGL01947:Slc12a3 APN 8 94365819 critical splice acceptor site probably null
IGL02151:Slc12a3 APN 8 94348592 missense probably benign 0.26
IGL02440:Slc12a3 APN 8 94331682 missense probably damaging 1.00
IGL03213:Slc12a3 APN 8 94335305 missense possibly damaging 0.95
IGL03260:Slc12a3 APN 8 94333242 missense probably damaging 1.00
IGL03306:Slc12a3 APN 8 94351758 missense possibly damaging 0.72
IGL03329:Slc12a3 APN 8 94365891 missense possibly damaging 0.67
avaricious UTSW 8 94330472 missense probably benign 0.01
Pugilist UTSW 8 94345773 critical splice acceptor site probably null
R0131:Slc12a3 UTSW 8 94340883 splice site probably benign
R0189:Slc12a3 UTSW 8 94356358 missense probably benign 0.30
R0330:Slc12a3 UTSW 8 94346346 missense possibly damaging 0.75
R0569:Slc12a3 UTSW 8 94330525 critical splice donor site probably null
R0715:Slc12a3 UTSW 8 94329433 missense possibly damaging 0.75
R1248:Slc12a3 UTSW 8 94333277 missense probably damaging 1.00
R1565:Slc12a3 UTSW 8 94345877 missense possibly damaging 0.75
R2068:Slc12a3 UTSW 8 94345828 missense probably damaging 1.00
R2108:Slc12a3 UTSW 8 94340530 missense probably damaging 0.97
R2273:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2274:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2275:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2433:Slc12a3 UTSW 8 94346316 missense probably benign 0.00
R3770:Slc12a3 UTSW 8 94353040 missense probably benign
R4429:Slc12a3 UTSW 8 94343085 missense probably damaging 1.00
R4431:Slc12a3 UTSW 8 94343085 missense probably damaging 1.00
R4533:Slc12a3 UTSW 8 94357086 missense probably null 0.02
R4627:Slc12a3 UTSW 8 94329384 missense probably benign
R4856:Slc12a3 UTSW 8 94351810 critical splice donor site probably null
R4886:Slc12a3 UTSW 8 94351810 critical splice donor site probably null
R4908:Slc12a3 UTSW 8 94348588 missense possibly damaging 0.76
R5054:Slc12a3 UTSW 8 94346351 missense probably damaging 1.00
R5299:Slc12a3 UTSW 8 94351789 missense probably damaging 1.00
R5451:Slc12a3 UTSW 8 94357027 missense possibly damaging 0.61
R5590:Slc12a3 UTSW 8 94345788 missense probably damaging 1.00
R5725:Slc12a3 UTSW 8 94330446 missense probably benign 0.00
R6038:Slc12a3 UTSW 8 94330472 missense probably benign 0.01
R6038:Slc12a3 UTSW 8 94330472 missense probably benign 0.01
R6162:Slc12a3 UTSW 8 94345773 critical splice acceptor site probably null
R6266:Slc12a3 UTSW 8 94358471 missense possibly damaging 0.93
R6489:Slc12a3 UTSW 8 94335004 missense possibly damaging 0.96
R6521:Slc12a3 UTSW 8 94343113 missense possibly damaging 0.84
R6882:Slc12a3 UTSW 8 94365918 missense possibly damaging 0.51
R7051:Slc12a3 UTSW 8 94365944 missense probably damaging 1.00
R7510:Slc12a3 UTSW 8 94365849 missense probably damaging 1.00
R7805:Slc12a3 UTSW 8 94344887 missense probably damaging 1.00
R8152:Slc12a3 UTSW 8 94330384 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTGTCCATGACCACACAG -3'
(R):5'- AGCCCAGTGATTCTTTGGTTTC -3'

Sequencing Primer
(F):5'- TGACCACACAGTAGCCCTTTGG -3'
(R):5'- CCACATCCTTAGGAGGGTTACAG -3'
Posted On2020-10-20