Incidental Mutation 'R8412:Nob1'
ID652748
Institutional Source Beutler Lab
Gene Symbol Nob1
Ensembl Gene ENSMUSG00000003848
Gene NameNIN1/RPN12 binding protein 1 homolog
SynonymsART-4, Nob1p, Psmd8bp1, 1700021I09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location107412486-107425051 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 107421598 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 71 (K71*)
Ref Sequence ENSEMBL: ENSMUSP00000003946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003946] [ENSMUST00000169311]
PDB Structure
Solution Structure of RSGI RUH-035, a Zn-ribbon module in Mouse cDNA [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000003946
AA Change: K71*
SMART Domains Protein: ENSMUSP00000003946
Gene: ENSMUSG00000003848
AA Change: K71*

DomainStartEndE-ValueType
PINc 5 108 2.28e-6 SMART
Pfam:AF1Q 135 211 1.8e-30 PFAM
Pfam:NOB1_Zn_bind 251 323 1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165266
SMART Domains Protein: ENSMUSP00000129298
Gene: ENSMUSG00000003848

DomainStartEndE-ValueType
Blast:PINc 5 61 9e-34 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000169311
AA Change: K71*
SMART Domains Protein: ENSMUSP00000126868
Gene: ENSMUSG00000003848
AA Change: K71*

DomainStartEndE-ValueType
PINc 5 108 2.28e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In yeast, over 200 protein and RNA cofactors are required for ribosome assembly, and these are generally conserved in eukaryotes. These factors orchestrate modification and cleavage of the initial 35S precursor rRNA transcript into the mature 18S, 5.8S, and 25S rRNAs, folding of the rRNA, and binding of ribosomal proteins and 5S RNA. Nob1 is involved in pre-rRNA processing. In a late cytoplasmic processing step, Nob1 cleaves a 20S rRNA intermediate at cleavage site D to produce the mature 18S rRNA (Lamanna and Karbstein, 2009 [PubMed 19706509]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Nob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Nob1 APN 8 107424728 splice site probably benign
IGL01661:Nob1 APN 8 107413182 missense probably damaging 1.00
IGL02110:Nob1 APN 8 107416172 makesense probably null
IGL03373:Nob1 APN 8 107418046 intron probably benign
PIT4531001:Nob1 UTSW 8 107418417 missense probably benign 0.01
R0627:Nob1 UTSW 8 107416224 missense probably damaging 1.00
R1181:Nob1 UTSW 8 107421490 missense probably damaging 1.00
R1264:Nob1 UTSW 8 107421504 missense probably damaging 0.99
R2257:Nob1 UTSW 8 107417097 intron probably benign
R4402:Nob1 UTSW 8 107418488 intron probably benign
R5330:Nob1 UTSW 8 107416249 missense probably damaging 1.00
R6907:Nob1 UTSW 8 107416228 missense possibly damaging 0.90
R7702:Nob1 UTSW 8 107413105 nonsense probably null
X0017:Nob1 UTSW 8 107424833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAAGGCCACTCTAATATTCCTT -3'
(R):5'- GTTGTGAGCCACCATGAGGA -3'

Sequencing Primer
(F):5'- CTGGTTCAGTGGTTAACAAAAGCCTG -3'
(R):5'- TTGTGAGCCACCATGAGGATACTG -3'
Posted On2020-10-20