Incidental Mutation 'R8412:Slc22a14'
ID652752
Institutional Source Beutler Lab
Gene Symbol Slc22a14
Ensembl Gene ENSMUSG00000070280
Gene Namesolute carrier family 22 (organic cation transporter), member 14
SynonymsLOC382113
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119169455-119365553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119180856 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 58 (I58V)
Ref Sequence ENSEMBL: ENSMUSP00000091289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093775] [ENSMUST00000127794] [ENSMUST00000170400]
Predicted Effect probably benign
Transcript: ENSMUST00000093775
AA Change: I58V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091289
Gene: ENSMUSG00000070280
AA Change: I58V

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 156 556 1.3e-28 PFAM
Pfam:MFS_1 178 514 7.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127794
Predicted Effect probably benign
Transcript: ENSMUST00000170400
AA Change: I58V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280
AA Change: I58V

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 3. The encoded protein is a transmembrane protein which is thought to transport small molecules and since this protein is conserved among several species, it is suggested to have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Slc22a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Slc22a14 APN 9 119178513 missense possibly damaging 0.58
R0086:Slc22a14 UTSW 9 119222738 critical splice donor site probably benign
R0505:Slc22a14 UTSW 9 119172034 splice site probably benign
R0593:Slc22a14 UTSW 9 119169851 missense probably benign 0.15
R0597:Slc22a14 UTSW 9 119172124 missense probably damaging 0.99
R0674:Slc22a14 UTSW 9 119178542 missense probably damaging 1.00
R1290:Slc22a14 UTSW 9 119178452 missense probably damaging 1.00
R1459:Slc22a14 UTSW 9 119223761 missense possibly damaging 0.70
R1706:Slc22a14 UTSW 9 119180984 missense probably benign 0.06
R3980:Slc22a14 UTSW 9 119178486 missense probably benign 0.02
R4166:Slc22a14 UTSW 9 119178432 missense probably benign 0.00
R4166:Slc22a14 UTSW 9 119179868 missense possibly damaging 0.53
R4574:Slc22a14 UTSW 9 119179495 missense probably damaging 0.99
R4959:Slc22a14 UTSW 9 119174035 small deletion probably benign
R4973:Slc22a14 UTSW 9 119174035 small deletion probably benign
R5273:Slc22a14 UTSW 9 119170638 missense probably benign 0.08
R5330:Slc22a14 UTSW 9 119230596 missense probably damaging 1.00
R5331:Slc22a14 UTSW 9 119230596 missense probably damaging 1.00
R5543:Slc22a14 UTSW 9 119173608 missense probably benign 0.01
R5801:Slc22a14 UTSW 9 119172083 missense probably benign 0.01
R6521:Slc22a14 UTSW 9 119220769 splice site probably null
R6622:Slc22a14 UTSW 9 119170577 missense possibly damaging 0.81
R6948:Slc22a14 UTSW 9 119231416 missense probably damaging 1.00
R7027:Slc22a14 UTSW 9 119231215 splice site probably null
R7731:Slc22a14 UTSW 9 119170611 missense possibly damaging 0.95
R7985:Slc22a14 UTSW 9 119170638 missense probably benign 0.01
R8508:Slc22a14 UTSW 9 119180585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCATCCTCTGTGAGATTGG -3'
(R):5'- ATACTGGGATCCGACGAAGG -3'

Sequencing Primer
(F):5'- TGAGATTGGGGCCCACTTC -3'
(R):5'- GCATCCTTTCTTTGAACAGATGAAGG -3'
Posted On2020-10-20