Incidental Mutation 'R8412:Med23'
ID652753
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24908734 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1200 (F1200L)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020159
AA Change: F1194L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: F1194L

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092646
AA Change: F1200L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: F1200L

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176285
AA Change: F834L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: F834L

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCAGTGGATGCAAGAGC -3'
(R):5'- CTCTGCAGTCCTCATGAGTG -3'

Sequencing Primer
(F):5'- CAGCGGGGCGGCAGATAG -3'
(R):5'- GAGAGCCACTTCCTTGTAAGTCAG -3'
Posted On2020-10-20