Incidental Mutation 'R8412:Arhgap23'
ID652757
Institutional Source Beutler Lab
Gene Symbol Arhgap23
Ensembl Gene ENSMUSG00000049807
Gene NameRho GTPase activating protein 23
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location97415533-97502402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97466028 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 884 (P884L)
Ref Sequence ENSEMBL: ENSMUSP00000112999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]
Predicted Effect probably benign
Transcript: ENSMUST00000107601
AA Change: P673L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807
AA Change: P673L

DomainStartEndE-ValueType
low complexity region 246 258 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 426 443 N/A INTRINSIC
PH 479 600 3.2e-12 SMART
low complexity region 679 687 N/A INTRINSIC
RhoGAP 707 884 6.83e-65 SMART
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1101 1114 N/A INTRINSIC
low complexity region 1125 1146 N/A INTRINSIC
low complexity region 1176 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121799
AA Change: P884L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: P884L

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
PDZ 52 160 4.2e-17 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 637 654 N/A INTRINSIC
PH 690 811 3.2e-12 SMART
low complexity region 890 898 N/A INTRINSIC
RhoGAP 918 1095 6.83e-65 SMART
low complexity region 1262 1277 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
low complexity region 1336 1357 N/A INTRINSIC
low complexity region 1387 1405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142465
AA Change: P373L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807
AA Change: P373L

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
PH 179 300 3.2e-12 SMART
low complexity region 379 387 N/A INTRINSIC
RhoGAP 407 584 6.83e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Arhgap23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgap23 APN 11 97492671 intron probably benign
IGL00493:Arhgap23 APN 11 97446553 critical splice donor site probably null
IGL01729:Arhgap23 APN 11 97453961 missense probably damaging 1.00
IGL01805:Arhgap23 APN 11 97492602 intron probably benign
IGL02005:Arhgap23 APN 11 97491219 missense probably damaging 0.99
IGL02026:Arhgap23 APN 11 97451581 missense probably damaging 0.99
IGL02135:Arhgap23 APN 11 97451702 missense probably damaging 0.97
IGL02178:Arhgap23 APN 11 97452353 missense probably benign 0.42
IGL02226:Arhgap23 APN 11 97451600 missense probably benign 0.07
IGL02309:Arhgap23 APN 11 97466001 splice site probably benign
IGL02399:Arhgap23 APN 11 97491005 intron probably benign
IGL02630:Arhgap23 APN 11 97454297 missense probably benign 0.24
IGL02724:Arhgap23 APN 11 97491179 missense probably damaging 0.99
IGL02740:Arhgap23 APN 11 97475017 missense probably damaging 1.00
IGL02746:Arhgap23 APN 11 97454204 splice site probably benign
IGL02862:Arhgap23 APN 11 97456480 missense probably damaging 1.00
IGL03380:Arhgap23 APN 11 97452518 missense probably damaging 1.00
R0091:Arhgap23 UTSW 11 97452244 missense probably benign 0.44
R0134:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0225:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0305:Arhgap23 UTSW 11 97501109 missense probably damaging 0.99
R0358:Arhgap23 UTSW 11 97463588 missense probably damaging 1.00
R0422:Arhgap23 UTSW 11 97463652 missense probably damaging 1.00
R0497:Arhgap23 UTSW 11 97452163 missense probably damaging 1.00
R0580:Arhgap23 UTSW 11 97446536 frame shift probably null
R0782:Arhgap23 UTSW 11 97500554 missense possibly damaging 0.73
R1216:Arhgap23 UTSW 11 97492672 intron probably benign
R1488:Arhgap23 UTSW 11 97500859 missense possibly damaging 0.53
R1785:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R1844:Arhgap23 UTSW 11 97463408 missense probably damaging 1.00
R1855:Arhgap23 UTSW 11 97448697 missense probably damaging 0.99
R1977:Arhgap23 UTSW 11 97451447 missense possibly damaging 0.95
R2064:Arhgap23 UTSW 11 97493062 missense probably benign 0.02
R2130:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R2431:Arhgap23 UTSW 11 97452404 missense probably benign
R2853:Arhgap23 UTSW 11 97492594 splice site probably null
R3767:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3768:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3769:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3770:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R4209:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R4247:Arhgap23 UTSW 11 97463699 missense probably damaging 1.00
R4997:Arhgap23 UTSW 11 97452020 missense probably damaging 0.98
R5399:Arhgap23 UTSW 11 97500917 missense probably damaging 0.97
R5549:Arhgap23 UTSW 11 97466568 missense probably damaging 0.96
R5655:Arhgap23 UTSW 11 97452546 critical splice donor site probably null
R5857:Arhgap23 UTSW 11 97451579 missense possibly damaging 0.93
R6013:Arhgap23 UTSW 11 97500992 missense probably damaging 0.99
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6077:Arhgap23 UTSW 11 97491232 critical splice donor site probably null
R6151:Arhgap23 UTSW 11 97500412 missense probably benign 0.01
R6393:Arhgap23 UTSW 11 97463672 missense probably damaging 0.98
R6693:Arhgap23 UTSW 11 97466517 missense probably damaging 1.00
R6752:Arhgap23 UTSW 11 97452248 missense probably damaging 0.98
R7202:Arhgap23 UTSW 11 97451993 missense possibly damaging 0.65
R7209:Arhgap23 UTSW 11 97476085 missense probably damaging 1.00
R7209:Arhgap23 UTSW 11 97492447 splice site probably null
R7320:Arhgap23 UTSW 11 97451545 missense probably benign 0.10
R7345:Arhgap23 UTSW 11 97466478 missense possibly damaging 0.91
R7599:Arhgap23 UTSW 11 97500343 missense probably benign
R8229:Arhgap23 UTSW 11 97453906 missense probably benign 0.36
R8460:Arhgap23 UTSW 11 97452371 missense probably damaging 1.00
R8492:Arhgap23 UTSW 11 97475021 missense probably damaging 1.00
R8525:Arhgap23 UTSW 11 97490084 missense probably damaging 1.00
RF020:Arhgap23 UTSW 11 97463561 missense probably damaging 1.00
V8831:Arhgap23 UTSW 11 97456545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGAGCCATGGTCTCCTTC -3'
(R):5'- CTGTGTACATGAGGAACGGG -3'

Sequencing Primer
(F):5'- CATGGTCTCCTTCCTGGGG -3'
(R):5'- GCAGCCGCTACATCCTC -3'
Posted On2020-10-20