Mutagenetix > Incidental Mutations

Incidental Mutation 'R8412:Arhgap23'

652757

Institutional Source

Beutler Lab

Gene Symbol

Arhgap23

Ensembl Gene

ENSMUSG00000049807

Gene Name

Rho GTPase activating protein 23

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8412 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

97415533-97502402 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 97466028 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 884 (P884L)

Ref Sequence

ENSEMBL: ENSMUSP00000112999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]

Predicted Effect

probably benign
Transcript: ENSMUST00000107601
AA Change: P673L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807
AA Change: P673L

Domain	Start	End	E-Value	Type
low complexity region	246	258	N/A	INTRINSIC
low complexity region	354	369	N/A	INTRINSIC
low complexity region	426	443	N/A	INTRINSIC
PH	479	600	3.2e-12	SMART
low complexity region	679	687	N/A	INTRINSIC
RhoGAP	707	884	6.83e-65	SMART
low complexity region	1051	1066	N/A	INTRINSIC
low complexity region	1101	1114	N/A	INTRINSIC
low complexity region	1125	1146	N/A	INTRINSIC
low complexity region	1176	1194	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121799
AA Change: P884L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: P884L

Domain	Start	End	E-Value	Type
low complexity region	8	29	N/A	INTRINSIC
PDZ	52	160	4.2e-17	SMART
low complexity region	457	469	N/A	INTRINSIC
low complexity region	565	580	N/A	INTRINSIC
low complexity region	637	654	N/A	INTRINSIC
PH	690	811	3.2e-12	SMART
low complexity region	890	898	N/A	INTRINSIC
RhoGAP	918	1095	6.83e-65	SMART
low complexity region	1262	1277	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
low complexity region	1336	1357	N/A	INTRINSIC
low complexity region	1387	1405	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142465
AA Change: P373L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807
AA Change: P373L

Domain	Start	End	E-Value	Type
low complexity region	54	69	N/A	INTRINSIC
low complexity region	126	143	N/A	INTRINSIC
PH	179	300	3.2e-12	SMART
low complexity region	379	387	N/A	INTRINSIC
RhoGAP	407	584	6.83e-65	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	T	A	1: 184,033,159	R234S	probably damaging	Het
Ace	T	A	11: 105,979,266	F806Y	probably benign	Het
Ak8	A	G	2: 28,739,631	T286A	probably benign	Het
Apba2	T	A	7: 64,745,798	F674Y	probably damaging	Het
Apob	A	G	12: 8,008,069	I2184V	probably benign	Het
Atg2a	T	C	19: 6,244,524	L90P	probably damaging	Het
Bhmt2	T	A	13: 93,662,312	I334F	possibly damaging	Het
Bmi1	C	T	2: 18,684,303	T266I	probably damaging	Het
Cdh26	A	G	2: 178,462,724	I301V	probably damaging	Het
Cenpx	A	T	11: 120,711,732	H68Q	unknown	Het
Cnot10	T	C	9: 114,610,670	R524G	probably benign	Het
Cnpy1	A	T	5: 28,209,208	Y22*	probably null	Het
Csmd3	C	T	15: 47,636,398	R2114H		Het
Defa29	T	A	8: 21,326,046	T102S	probably benign	Het
Fras1	T	C	5: 96,596,852	I582T	probably benign	Het
Gm14295	G	A	2: 176,809,629	C304Y	probably damaging	Het
Gucy2d	T	C	7: 98,443,839	V141A	possibly damaging	Het
Ifi47	A	C	11: 49,095,598	Q64P	probably damaging	Het
Irx3	G	T	8: 91,800,400	S225R	possibly damaging	Het
Itpr1	A	G	6: 108,363,620	H289R	probably benign	Het
Lamc3	A	G	2: 31,912,116	D512G	probably damaging	Het
Mcm3	C	T	1: 20,816,756	V142I	probably benign	Het
Med23	C	A	10: 24,908,734	F1200L	probably benign	Het
Ndst4	A	T	3: 125,570,790	D372V	possibly damaging	Het
Nob1	T	A	8: 107,421,598	K71*	probably null	Het
Ntrk3	A	G	7: 78,356,149	I488T	probably benign	Het
Pds5b	G	T	5: 150,719,959	C82F	probably damaging	Het
Pkd1l3	T	A	8: 109,633,390	V969E	possibly damaging	Het
Ppme1	A	T	7: 100,335,091	N307K	probably benign	Het
Pus7l	C	T	15: 94,527,975	C515Y	probably benign	Het
Rpp21	T	A	17: 36,257,699	H22L	possibly damaging	Het
Scamp3	T	C	3: 89,181,218	F244L	probably damaging	Het
Scgb1b7	A	T	7: 31,712,954	K52*	probably null	Het
Slc12a3	T	C	8: 94,334,067	I261T	probably damaging	Het
Slc19a3	C	T	1: 83,014,812	R396H	probably damaging	Het
Slc22a14	T	C	9: 119,180,856	I58V	probably benign	Het
Slc9a9	A	C	9: 95,229,039	T637P	probably damaging	Het
Snrnp40	T	A	4: 130,384,523	C274S	possibly damaging	Het
Sptbn1	A	G	11: 30,138,457	V905A	probably damaging	Het
Taok3	A	G	5: 117,266,037	D759G	possibly damaging	Het
Tas1r1	T	C	4: 152,032,576	I200M	probably benign	Het
Tnfrsf25	T	C	4: 152,119,682	V360A	possibly damaging	Het
Trim12a	A	T	7: 104,304,337	M189K	possibly damaging	Het
Tspan32	T	C	7: 143,005,958	F41L	probably benign	Het
Tube1	T	A	10: 39,145,661	S301T	possibly damaging	Het
Usp8	T	C	2: 126,742,658	S596P	probably benign	Het
Virma	T	A	4: 11,521,261		probably null	Het
Vmn2r58	T	C	7: 41,864,298	D307G	probably benign	Het
Zeb2	T	C	2: 44,998,952	K327R	probably damaging	Het
Zfp54	C	T	17: 21,434,648	T468M	probably benign	Het
Zfp780b	A	T	7: 27,963,126	I668N	possibly damaging	Het

Other mutations in Arhgap23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Arhgap23	APN	11	97492671	intron	probably benign
IGL00493:Arhgap23	APN	11	97446553	critical splice donor site	probably null
IGL01729:Arhgap23	APN	11	97453961	missense	probably damaging	1.00
IGL01805:Arhgap23	APN	11	97492602	intron	probably benign
IGL02005:Arhgap23	APN	11	97491219	missense	probably damaging	0.99
IGL02026:Arhgap23	APN	11	97451581	missense	probably damaging	0.99
IGL02135:Arhgap23	APN	11	97451702	missense	probably damaging	0.97
IGL02178:Arhgap23	APN	11	97452353	missense	probably benign	0.42
IGL02226:Arhgap23	APN	11	97451600	missense	probably benign	0.07
IGL02309:Arhgap23	APN	11	97466001	splice site	probably benign
IGL02399:Arhgap23	APN	11	97491005	intron	probably benign
IGL02630:Arhgap23	APN	11	97454297	missense	probably benign	0.24
IGL02724:Arhgap23	APN	11	97491179	missense	probably damaging	0.99
IGL02740:Arhgap23	APN	11	97475017	missense	probably damaging	1.00
IGL02746:Arhgap23	APN	11	97454204	splice site	probably benign
IGL02862:Arhgap23	APN	11	97456480	missense	probably damaging	1.00
IGL03380:Arhgap23	APN	11	97452518	missense	probably damaging	1.00
R0091:Arhgap23	UTSW	11	97452244	missense	probably benign	0.44
R0134:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0225:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0305:Arhgap23	UTSW	11	97501109	missense	probably damaging	0.99
R0358:Arhgap23	UTSW	11	97463588	missense	probably damaging	1.00
R0422:Arhgap23	UTSW	11	97463652	missense	probably damaging	1.00
R0497:Arhgap23	UTSW	11	97452163	missense	probably damaging	1.00
R0580:Arhgap23	UTSW	11	97446536	frame shift	probably null
R0782:Arhgap23	UTSW	11	97500554	missense	possibly damaging	0.73
R1216:Arhgap23	UTSW	11	97492672	intron	probably benign
R1488:Arhgap23	UTSW	11	97500859	missense	possibly damaging	0.53
R1785:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R1844:Arhgap23	UTSW	11	97463408	missense	probably damaging	1.00
R1855:Arhgap23	UTSW	11	97448697	missense	probably damaging	0.99
R1977:Arhgap23	UTSW	11	97451447	missense	possibly damaging	0.95
R2064:Arhgap23	UTSW	11	97493062	missense	probably benign	0.02
R2130:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R2431:Arhgap23	UTSW	11	97452404	missense	probably benign
R2853:Arhgap23	UTSW	11	97492594	splice site	probably null
R3767:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3768:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3769:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3770:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R4209:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R4247:Arhgap23	UTSW	11	97463699	missense	probably damaging	1.00
R4997:Arhgap23	UTSW	11	97452020	missense	probably damaging	0.98
R5399:Arhgap23	UTSW	11	97500917	missense	probably damaging	0.97
R5549:Arhgap23	UTSW	11	97466568	missense	probably damaging	0.96
R5655:Arhgap23	UTSW	11	97452546	critical splice donor site	probably null
R5857:Arhgap23	UTSW	11	97451579	missense	possibly damaging	0.93
R6013:Arhgap23	UTSW	11	97500992	missense	probably damaging	0.99
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6077:Arhgap23	UTSW	11	97491232	critical splice donor site	probably null
R6151:Arhgap23	UTSW	11	97500412	missense	probably benign	0.01
R6393:Arhgap23	UTSW	11	97463672	missense	probably damaging	0.98
R6693:Arhgap23	UTSW	11	97466517	missense	probably damaging	1.00
R6752:Arhgap23	UTSW	11	97452248	missense	probably damaging	0.98
R7202:Arhgap23	UTSW	11	97451993	missense	possibly damaging	0.65
R7209:Arhgap23	UTSW	11	97476085	missense	probably damaging	1.00
R7209:Arhgap23	UTSW	11	97492447	splice site	probably null
R7320:Arhgap23	UTSW	11	97451545	missense	probably benign	0.10
R7345:Arhgap23	UTSW	11	97466478	missense	possibly damaging	0.91
R7599:Arhgap23	UTSW	11	97500343	missense	probably benign
R8229:Arhgap23	UTSW	11	97453906	missense	probably benign	0.36
R8460:Arhgap23	UTSW	11	97452371	missense	probably damaging	1.00
R8492:Arhgap23	UTSW	11	97475021	missense	probably damaging	1.00
R8525:Arhgap23	UTSW	11	97490084	missense	probably damaging	1.00
RF020:Arhgap23	UTSW	11	97463561	missense	probably damaging	1.00
V8831:Arhgap23	UTSW	11	97456545	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATGGAGCCATGGTCTCCTTC -3'
(R):5'- CTGTGTACATGAGGAACGGG -3'

Sequencing Primer
(F):5'- CATGGTCTCCTTCCTGGGG -3'
(R):5'- GCAGCCGCTACATCCTC -3'

Posted On

2020-10-20