Incidental Mutation 'R8412:Ace'
ID652758
Institutional Source Beutler Lab
Gene Symbol Ace
Ensembl Gene ENSMUSG00000020681
Gene Nameangiotensin I converting enzyme (peptidyl-dipeptidase A) 1
SynonymsCD143
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location105967945-105989964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105979266 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 806 (F806Y)
Ref Sequence ENSEMBL: ENSMUSP00000001963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001963] [ENSMUST00000001964]
Predicted Effect probably benign
Transcript: ENSMUST00000001963
AA Change: F806Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001963
Gene: ENSMUSG00000020681
AA Change: F806Y

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Peptidase_M2 45 628 7.1e-257 PFAM
Pfam:Peptidase_M2 648 1226 8.9e-261 PFAM
transmembrane domain 1264 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001964
AA Change: F226Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001964
Gene: ENSMUSG00000020681
AA Change: F226Y

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_M2 59 653 N/A PFAM
transmembrane domain 684 706 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681
AA Change: F572Y

DomainStartEndE-ValueType
Pfam:Peptidase_M2 1 395 2.4e-201 PFAM
Pfam:Peptidase_M2 415 993 1.4e-261 PFAM
low complexity region 999 1014 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, respectively, that are equally active. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable phenotypes, including reduced systemic blood pressure, normocytic anemia, renal abnormalities, inability to concentrate urine, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Ace
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ace APN 11 105979550 missense probably benign 0.21
IGL01105:Ace APN 11 105972059 missense probably damaging 1.00
IGL01761:Ace APN 11 105979493 missense possibly damaging 0.70
IGL01888:Ace APN 11 105968944 missense probably benign
IGL02173:Ace APN 11 105988991 missense probably benign 0.04
IGL02179:Ace APN 11 105969789 missense probably benign 0.16
IGL02331:Ace APN 11 105971344 missense possibly damaging 0.61
IGL02333:Ace APN 11 105971447 missense probably benign
IGL02556:Ace APN 11 105972527 missense probably damaging 1.00
IGL02576:Ace APN 11 105974111 missense probably damaging 1.00
IGL03202:Ace APN 11 105976962 missense probably damaging 1.00
R0403:Ace UTSW 11 105973880 splice site probably null
R0709:Ace UTSW 11 105981538 missense probably damaging 0.97
R1555:Ace UTSW 11 105974901 splice site probably null
R1603:Ace UTSW 11 105972099 missense probably benign 0.23
R1644:Ace UTSW 11 105985106 missense probably damaging 1.00
R1834:Ace UTSW 11 105986094 splice site probably benign
R2074:Ace UTSW 11 105976623 nonsense probably null
R3025:Ace UTSW 11 105974093 splice site probably null
R3176:Ace UTSW 11 105976702 missense probably null 1.00
R3276:Ace UTSW 11 105976702 missense probably null 1.00
R3977:Ace UTSW 11 105981838 missense possibly damaging 0.96
R4506:Ace UTSW 11 105976666 missense probably damaging 0.98
R4598:Ace UTSW 11 105981759 splice site probably null
R4914:Ace UTSW 11 105979597 missense probably damaging 1.00
R4968:Ace UTSW 11 105981853 missense possibly damaging 0.93
R5137:Ace UTSW 11 105974826 missense probably damaging 1.00
R5274:Ace UTSW 11 105968037 missense probably benign
R5332:Ace UTSW 11 105973879 critical splice donor site probably null
R5388:Ace UTSW 11 105988458 missense possibly damaging 0.85
R5425:Ace UTSW 11 105973428 missense probably damaging 1.00
R5640:Ace UTSW 11 105970685 missense probably damaging 1.00
R5838:Ace UTSW 11 105972880 missense probably benign 0.00
R6041:Ace UTSW 11 105975308 missense probably benign 0.27
R6083:Ace UTSW 11 105985267 nonsense probably null
R6106:Ace UTSW 11 105989012 missense probably damaging 1.00
R6225:Ace UTSW 11 105979619 missense possibly damaging 0.51
R6607:Ace UTSW 11 105972377 missense possibly damaging 0.82
R6918:Ace UTSW 11 105972943 missense probably damaging 1.00
R7330:Ace UTSW 11 105986061 missense probably damaging 1.00
R7471:Ace UTSW 11 105973482 missense probably damaging 1.00
R7709:Ace UTSW 11 105988837 missense probably benign 0.01
R7800:Ace UTSW 11 105986058 missense probably damaging 1.00
R7855:Ace UTSW 11 105972379 missense probably benign 0.05
R7947:Ace UTSW 11 105973054 missense possibly damaging 0.81
R8063:Ace UTSW 11 105971364 missense possibly damaging 0.90
R8072:Ace UTSW 11 105972959 missense probably damaging 0.98
R8544:Ace UTSW 11 105971290 critical splice acceptor site probably null
X0018:Ace UTSW 11 105971384 missense probably damaging 1.00
X0063:Ace UTSW 11 105975638 missense probably benign 0.07
Z1177:Ace UTSW 11 105988134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATTTCCAAGTGCTCTTACCAG -3'
(R):5'- GTCAAGCTCTTCCAACAGCC -3'

Sequencing Primer
(F):5'- ACCAGTTTTATTCCAACTCTGAAAC -3'
(R):5'- GCCATCACTTACCCAATATGTCC -3'
Posted On2020-10-20