Incidental Mutation 'R8412:Cenpx'
ID652759
Institutional Source Beutler Lab
Gene Symbol Cenpx
Ensembl Gene ENSMUSG00000025144
Gene Namecentromere protein X
SynonymsStra13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location120710942-120713738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120711732 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 68 (H68Q)
Ref Sequence ENSEMBL: ENSMUSP00000101761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026135] [ENSMUST00000026137] [ENSMUST00000026139] [ENSMUST00000055424] [ENSMUST00000103016] [ENSMUST00000106154] [ENSMUST00000106155] [ENSMUST00000106158] [ENSMUST00000106159] [ENSMUST00000106160] [ENSMUST00000145781] [ENSMUST00000151852] [ENSMUST00000168510] [ENSMUST00000168714] [ENSMUST00000168947]
Predicted Effect probably benign
Transcript: ENSMUST00000026135
SMART Domains Protein: ENSMUSP00000026135
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
Pfam:TUG-UBL1 15 78 1.4e-29 PFAM
low complexity region 193 206 N/A INTRINSIC
low complexity region 284 313 N/A INTRINSIC
coiled coil region 339 365 N/A INTRINSIC
UBX 378 459 1.67e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000026137
AA Change: M64K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026137
Gene: ENSMUSG00000025144
AA Change: M64K

DomainStartEndE-ValueType
Pfam:CENP-X 55 107 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026139
SMART Domains Protein: ENSMUSP00000026139
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 4e-11 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 645 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000055424
AA Change: M35K

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050335
Gene: ENSMUSG00000025144
AA Change: M35K

DomainStartEndE-ValueType
Pfam:CENP-X 8 78 7.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103016
SMART Domains Protein: ENSMUSP00000099305
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106154
AA Change: M71K

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101760
Gene: ENSMUSG00000025144
AA Change: M71K

DomainStartEndE-ValueType
Pfam:CENP-X 44 114 6.1e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000106155
AA Change: H68Q
SMART Domains Protein: ENSMUSP00000101761
Gene: ENSMUSG00000025144
AA Change: H68Q

DomainStartEndE-ValueType
low complexity region 39 50 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106158
SMART Domains Protein: ENSMUSP00000101764
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106159
SMART Domains Protein: ENSMUSP00000101765
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106160
SMART Domains Protein: ENSMUSP00000101766
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145781
SMART Domains Protein: ENSMUSP00000123038
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 1e-10 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151852
SMART Domains Protein: ENSMUSP00000115298
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
Pfam:LRR_6 85 108 1e-2 PFAM
Blast:LRR 113 142 3e-11 BLAST
Pfam:LRR_6 143 162 7.6e-3 PFAM
Pfam:LRR_1 145 159 6.8e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166838
SMART Domains Protein: ENSMUSP00000127202
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
coiled coil region 49 75 N/A INTRINSIC
Blast:UBX 89 119 7e-13 BLAST
SCOP:d1i42a_ 92 119 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167678
SMART Domains Protein: ENSMUSP00000128940
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
coiled coil region 37 63 N/A INTRINSIC
Blast:UBX 77 107 8e-13 BLAST
SCOP:d1i42a_ 80 107 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168510
SMART Domains Protein: ENSMUSP00000125931
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168714
SMART Domains Protein: ENSMUSP00000129462
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
SCOP:d1h8ca_ 12 82 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168947
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Atg2a T C 19: 6,244,524 L90P probably damaging Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Cenpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4798:Cenpx UTSW 11 120711784 unclassified probably benign
X0022:Cenpx UTSW 11 120712451 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCCTGCCCTTGTTAGGTC -3'
(R):5'- TGAGGAATGGCACTGACTCTG -3'

Sequencing Primer
(F):5'- CCCATTGTCAGCCCTCAGAG -3'
(R):5'- ACTGACTCTGCCCTCCTTCTAGG -3'
Posted On2020-10-20