Incidental Mutation 'R8412:Atg2a'
ID652766
Institutional Source Beutler Lab
Gene Symbol Atg2a
Ensembl Gene ENSMUSG00000024773
Gene Nameautophagy related 2A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R8412 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6241668-6262335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6244524 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 90 (L90P)
Ref Sequence ENSEMBL: ENSMUSP00000046412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045351]
Predicted Effect probably damaging
Transcript: ENSMUST00000045351
AA Change: L90P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046412
Gene: ENSMUSG00000024773
AA Change: L90P

DomainStartEndE-ValueType
Pfam:Chorein_N 14 131 7.6e-20 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 501 512 N/A INTRINSIC
low complexity region 852 863 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
low complexity region 1429 1446 N/A INTRINSIC
low complexity region 1761 1773 N/A INTRINSIC
Pfam:ATG_C 1814 1908 2.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145600
SMART Domains Protein: ENSMUSP00000114998
Gene: ENSMUSG00000024773

DomainStartEndE-ValueType
low complexity region 87 103 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 871 883 N/A INTRINSIC
low complexity region 1233 1250 N/A INTRINSIC
low complexity region 1565 1577 N/A INTRINSIC
Pfam:ATG_C 1618 1712 3.6e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T A 1: 184,033,159 R234S probably damaging Het
Ace T A 11: 105,979,266 F806Y probably benign Het
Ak8 A G 2: 28,739,631 T286A probably benign Het
Apba2 T A 7: 64,745,798 F674Y probably damaging Het
Apob A G 12: 8,008,069 I2184V probably benign Het
Arhgap23 C T 11: 97,466,028 P884L probably benign Het
Bhmt2 T A 13: 93,662,312 I334F possibly damaging Het
Bmi1 C T 2: 18,684,303 T266I probably damaging Het
Cdh26 A G 2: 178,462,724 I301V probably damaging Het
Cenpx A T 11: 120,711,732 H68Q unknown Het
Cnot10 T C 9: 114,610,670 R524G probably benign Het
Cnpy1 A T 5: 28,209,208 Y22* probably null Het
Csmd3 C T 15: 47,636,398 R2114H Het
Defa29 T A 8: 21,326,046 T102S probably benign Het
Fras1 T C 5: 96,596,852 I582T probably benign Het
Gm14295 G A 2: 176,809,629 C304Y probably damaging Het
Gucy2d T C 7: 98,443,839 V141A possibly damaging Het
Ifi47 A C 11: 49,095,598 Q64P probably damaging Het
Irx3 G T 8: 91,800,400 S225R possibly damaging Het
Itpr1 A G 6: 108,363,620 H289R probably benign Het
Lamc3 A G 2: 31,912,116 D512G probably damaging Het
Mcm3 C T 1: 20,816,756 V142I probably benign Het
Med23 C A 10: 24,908,734 F1200L probably benign Het
Ndst4 A T 3: 125,570,790 D372V possibly damaging Het
Nob1 T A 8: 107,421,598 K71* probably null Het
Ntrk3 A G 7: 78,356,149 I488T probably benign Het
Pds5b G T 5: 150,719,959 C82F probably damaging Het
Pkd1l3 T A 8: 109,633,390 V969E possibly damaging Het
Ppme1 A T 7: 100,335,091 N307K probably benign Het
Pus7l C T 15: 94,527,975 C515Y probably benign Het
Rpp21 T A 17: 36,257,699 H22L possibly damaging Het
Scamp3 T C 3: 89,181,218 F244L probably damaging Het
Scgb1b7 A T 7: 31,712,954 K52* probably null Het
Slc12a3 T C 8: 94,334,067 I261T probably damaging Het
Slc19a3 C T 1: 83,014,812 R396H probably damaging Het
Slc22a14 T C 9: 119,180,856 I58V probably benign Het
Slc9a9 A C 9: 95,229,039 T637P probably damaging Het
Snrnp40 T A 4: 130,384,523 C274S possibly damaging Het
Sptbn1 A G 11: 30,138,457 V905A probably damaging Het
Taok3 A G 5: 117,266,037 D759G possibly damaging Het
Tas1r1 T C 4: 152,032,576 I200M probably benign Het
Tnfrsf25 T C 4: 152,119,682 V360A possibly damaging Het
Trim12a A T 7: 104,304,337 M189K possibly damaging Het
Tspan32 T C 7: 143,005,958 F41L probably benign Het
Tube1 T A 10: 39,145,661 S301T possibly damaging Het
Usp8 T C 2: 126,742,658 S596P probably benign Het
Virma T A 4: 11,521,261 probably null Het
Vmn2r58 T C 7: 41,864,298 D307G probably benign Het
Zeb2 T C 2: 44,998,952 K327R probably damaging Het
Zfp54 C T 17: 21,434,648 T468M probably benign Het
Zfp780b A T 7: 27,963,126 I668N possibly damaging Het
Other mutations in Atg2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Atg2a APN 19 6254599 missense probably damaging 1.00
IGL01612:Atg2a APN 19 6252484 missense probably benign 0.03
IGL02105:Atg2a APN 19 6250403 splice site probably benign
IGL02151:Atg2a APN 19 6255757 missense possibly damaging 0.95
IGL02228:Atg2a APN 19 6246800 missense probably benign 0.29
IGL02329:Atg2a APN 19 6249929 critical splice donor site probably null
IGL02408:Atg2a APN 19 6241828 nonsense probably null
IGL02538:Atg2a APN 19 6257628 missense probably benign
IGL02830:Atg2a APN 19 6247681 missense probably benign 0.04
IGL03349:Atg2a APN 19 6258024 missense possibly damaging 0.77
PIT4515001:Atg2a UTSW 19 6253585 missense probably damaging 1.00
R0099:Atg2a UTSW 19 6252789 missense probably damaging 0.97
R0212:Atg2a UTSW 19 6246554 missense probably damaging 1.00
R0365:Atg2a UTSW 19 6247683 missense possibly damaging 0.51
R0398:Atg2a UTSW 19 6246578 missense probably damaging 1.00
R0483:Atg2a UTSW 19 6256601 missense probably damaging 0.98
R0483:Atg2a UTSW 19 6256602 missense probably benign 0.01
R0494:Atg2a UTSW 19 6253377 missense probably damaging 1.00
R0511:Atg2a UTSW 19 6252539 missense possibly damaging 0.89
R0590:Atg2a UTSW 19 6245007 unclassified probably benign
R0592:Atg2a UTSW 19 6245007 unclassified probably benign
R0593:Atg2a UTSW 19 6245007 unclassified probably benign
R0630:Atg2a UTSW 19 6244517 missense probably damaging 0.99
R1306:Atg2a UTSW 19 6253021 missense probably benign 0.31
R1437:Atg2a UTSW 19 6250616 missense probably damaging 1.00
R1539:Atg2a UTSW 19 6246771 splice site probably null
R1774:Atg2a UTSW 19 6250598 missense probably benign 0.01
R1781:Atg2a UTSW 19 6256213 missense probably damaging 0.96
R1854:Atg2a UTSW 19 6252431 missense probably benign 0.11
R1884:Atg2a UTSW 19 6254384 missense probably damaging 1.00
R1899:Atg2a UTSW 19 6245067 missense probably damaging 1.00
R1935:Atg2a UTSW 19 6252536 missense probably damaging 1.00
R2020:Atg2a UTSW 19 6250269 critical splice donor site probably null
R2071:Atg2a UTSW 19 6257458 missense probably benign 0.00
R2513:Atg2a UTSW 19 6258046 critical splice donor site probably null
R3808:Atg2a UTSW 19 6252816 missense possibly damaging 0.71
R4065:Atg2a UTSW 19 6258366 missense probably damaging 1.00
R4109:Atg2a UTSW 19 6258374 missense possibly damaging 0.95
R4352:Atg2a UTSW 19 6257457 missense probably benign 0.04
R4440:Atg2a UTSW 19 6255829 critical splice donor site probably null
R4472:Atg2a UTSW 19 6258955 missense probably damaging 0.98
R4669:Atg2a UTSW 19 6258987 critical splice donor site probably null
R4878:Atg2a UTSW 19 6250244 missense probably damaging 1.00
R4926:Atg2a UTSW 19 6257533 missense probably damaging 0.96
R5237:Atg2a UTSW 19 6246814 missense probably benign
R5350:Atg2a UTSW 19 6251338 missense probably damaging 0.99
R5507:Atg2a UTSW 19 6245070 missense possibly damaging 0.94
R5732:Atg2a UTSW 19 6257460 missense probably damaging 1.00
R5784:Atg2a UTSW 19 6261505 missense probably damaging 1.00
R5960:Atg2a UTSW 19 6254360 missense probably damaging 1.00
R5985:Atg2a UTSW 19 6254637 missense probably damaging 1.00
R6175:Atg2a UTSW 19 6241729 unclassified probably benign
R6572:Atg2a UTSW 19 6254665 missense probably damaging 0.98
R6878:Atg2a UTSW 19 6250178 missense probably damaging 0.99
R6879:Atg2a UTSW 19 6251852 missense possibly damaging 0.70
R6983:Atg2a UTSW 19 6260040 missense probably damaging 0.99
R7024:Atg2a UTSW 19 6250219 missense possibly damaging 0.88
R7217:Atg2a UTSW 19 6253441 critical splice donor site probably null
R7384:Atg2a UTSW 19 6261677 missense probably damaging 1.00
R7387:Atg2a UTSW 19 6255168 missense possibly damaging 0.79
R7425:Atg2a UTSW 19 6255652 missense probably benign 0.02
R7512:Atg2a UTSW 19 6260076 missense probably damaging 1.00
R7658:Atg2a UTSW 19 6251263 missense probably damaging 1.00
R7893:Atg2a UTSW 19 6251296 missense probably damaging 1.00
R8062:Atg2a UTSW 19 6252579 critical splice donor site probably null
R8258:Atg2a UTSW 19 6249829 missense probably damaging 0.98
R8259:Atg2a UTSW 19 6249829 missense probably damaging 0.98
R8350:Atg2a UTSW 19 6246811 missense probably benign 0.03
R8450:Atg2a UTSW 19 6246811 missense probably benign 0.03
R8474:Atg2a UTSW 19 6251403 critical splice donor site probably null
R8501:Atg2a UTSW 19 6254390 missense probably damaging 1.00
R8738:Atg2a UTSW 19 6256644 missense probably benign 0.00
R8786:Atg2a UTSW 19 6244430 missense probably damaging 1.00
R8810:Atg2a UTSW 19 6250621 missense probably benign 0.01
X0065:Atg2a UTSW 19 6258196 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGACAGTGGCTGTGTGAGAC -3'
(R):5'- CTGCAAGCTTGTGGTCATG -3'

Sequencing Primer
(F):5'- TGAGACTGTGGCAGGTAGC -3'
(R):5'- ATGAGGCCCAACTCTGAGAGTC -3'
Posted On2020-10-20