Incidental Mutation 'R8413:Cfap65'
ID652767
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R8413 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 74917169 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1084 (K1084*)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect probably null
Transcript: ENSMUST00000094844
AA Change: K1084*
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: K1084*

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,423,900 D86E probably benign Het
Adamts5 A G 16: 85,866,618 probably null Het
Arhgap31 T C 16: 38,602,921 R928G possibly damaging Het
Birc6 T C 17: 74,546,393 V164A possibly damaging Het
Cdh26 T A 2: 178,468,229 H438Q probably damaging Het
Csmd1 T C 8: 15,900,676 H3511R probably damaging Het
Ebf1 T A 11: 44,643,447 S178T possibly damaging Het
Eln A G 5: 134,726,521 V226A unknown Het
Fat4 A T 3: 39,008,979 probably null Het
Gcn1l1 C T 5: 115,579,639 T222I probably benign Het
Gm11639 A C 11: 104,920,309 K3192N unknown Het
Gm5624 T G 14: 44,561,890 N70T Het
Gpc6 T A 14: 117,892,349 V387E possibly damaging Het
Gyg C T 3: 20,125,455 V255M probably damaging Het
Henmt1 T A 3: 108,957,649 F146I probably damaging Het
Itpr3 T A 17: 27,111,926 L1736Q probably damaging Het
Kcnh4 A G 11: 100,749,793 V469A possibly damaging Het
Mybpc2 A G 7: 44,508,305 L750P probably damaging Het
Naalad2 A G 9: 18,330,643 V655A probably damaging Het
Nme8 C T 13: 19,674,519 D289N probably benign Het
Olfr1109 T C 2: 87,093,158 K80E probably benign Het
Olfr1199 T A 2: 88,756,680 probably benign Het
Olfr358 T G 2: 37,005,390 T75P probably damaging Het
Olfr720 A G 14: 14,175,416 V222A probably benign Het
Olfr727 C G 14: 50,127,370 S264R probably benign Het
Olfr948 T A 9: 39,319,105 K170* probably null Het
Phf24 T A 4: 42,937,906 C173* probably null Het
Plcb2 A G 2: 118,718,823 F353L probably damaging Het
Prss33 C A 17: 23,833,956 W248L probably damaging Het
Rgs3 T G 4: 62,626,017 L350R possibly damaging Het
Samd11 C T 4: 156,249,273 G200D probably damaging Het
Sh3tc2 T A 18: 61,990,802 V878E probably damaging Het
Sh3tc2 G C 18: 62,015,071 G1284A probably benign Het
Skint5 A G 4: 113,715,703 S780P unknown Het
Slc8a3 T C 12: 81,314,678 K456E probably damaging Het
Smok2a T A 17: 13,225,612 H25Q probably benign Het
Srrt A G 5: 137,300,327 L225P possibly damaging Het
Stox1 C T 10: 62,664,975 R602Q probably damaging Het
Tmem30a A T 9: 79,776,225 C157S probably damaging Het
Tnks1bp1 T C 2: 85,062,278 S850P probably damaging Het
Trpm6 A G 19: 18,832,485 I1082V probably benign Het
Ttll5 T A 12: 85,919,121 N646K probably benign Het
Vmn1r179 A T 7: 23,928,852 Y156F probably benign Het
Vmn1r54 T A 6: 90,269,431 L109H probably damaging Het
Wdr17 T C 8: 54,662,918 I617V probably benign Het
Zeb2 T A 2: 44,996,171 Q958L probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAACCTTGGGTGCCCATC -3'
(R):5'- AAAGAAAGCCCTGTGCCACG -3'

Sequencing Primer
(F):5'- CCCCAGGCACAAAGTGAAAGATG -3'
(R):5'- TGTGCCACGTGTCCCTG -3'
Posted On2020-10-20